Incidental Mutation 'R0130:Cped1'
ID50110
Institutional Source Beutler Lab
Gene Symbol Cped1
Ensembl Gene ENSMUSG00000062980
Gene Namecadherin-like and PC-esterase domain containing 1
SynonymsA430107O13Rik
MMRRC Submission 038415-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R0130 (G1)
Quality Score170
Status Validated (trace)
Chromosome6
Chromosomal Location21985916-22256404 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 22121039 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 373 (Y373N)
Ref Sequence ENSEMBL: ENSMUSP00000111040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115382] [ENSMUST00000115383] [ENSMUST00000153922]
Predicted Effect probably benign
Transcript: ENSMUST00000115382
AA Change: Y373N

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000111040
Gene: ENSMUSG00000062980
AA Change: Y373N

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
low complexity region 110 122 N/A INTRINSIC
low complexity region 133 147 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115383
AA Change: Y373N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000111041
Gene: ENSMUSG00000062980
AA Change: Y373N

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
low complexity region 110 122 N/A INTRINSIC
low complexity region 133 147 N/A INTRINSIC
Pfam:Cadherin-like 574 663 1e-9 PFAM
Pfam:PC-Esterase 753 1018 2e-26 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000137437
AA Change: Y235N
SMART Domains Protein: ENSMUSP00000119808
Gene: ENSMUSG00000062980
AA Change: Y235N

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
low complexity region 110 122 N/A INTRINSIC
low complexity region 133 147 N/A INTRINSIC
Pfam:Cadherin-like 570 663 6.2e-12 PFAM
Pfam:PC-Esterase 753 963 1.6e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153922
SMART Domains Protein: ENSMUSP00000138562
Gene: ENSMUSG00000062980

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
low complexity region 110 122 N/A INTRINSIC
low complexity region 130 142 N/A INTRINSIC
Meta Mutation Damage Score 0.168 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.7%
  • 10x: 93.4%
  • 20x: 80.2%
Validation Efficiency 99% (84/85)
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg8 A T 17: 84,686,666 Y37F probably damaging Het
Ablim2 G A 5: 35,809,176 probably benign Het
Anxa9 A G 3: 95,302,422 S129P probably benign Het
Apol7c A G 15: 77,526,362 I128T possibly damaging Het
Arfgef2 T G 2: 166,835,719 I88S probably damaging Het
Arfip2 A G 7: 105,638,998 probably benign Het
Atp5j2 A T 5: 145,188,182 probably benign Het
Atp7b C T 8: 22,028,172 E205K possibly damaging Het
Atp8b5 T A 4: 43,369,715 probably null Het
Cd22 A G 7: 30,869,964 Y402H possibly damaging Het
Cd248 A G 19: 5,069,962 T613A probably benign Het
Cdcp2 C T 4: 107,106,707 probably benign Het
Cenpc1 A T 5: 86,046,546 D120E probably benign Het
Chd3 T A 11: 69,359,830 H691L probably damaging Het
Colec12 C T 18: 9,858,921 P568L unknown Het
Cr2 A T 1: 195,166,231 V328D probably damaging Het
Ctnnd2 A T 15: 30,921,913 E895V probably damaging Het
D630045J12Rik A T 6: 38,149,771 probably benign Het
Dcdc2a A T 13: 25,187,672 probably benign Het
Dync1h1 C A 12: 110,618,674 T837K probably benign Het
Eif2ak3 C A 6: 70,881,732 probably benign Het
Epb41l5 A C 1: 119,549,902 V705G possibly damaging Het
Fat2 T A 11: 55,252,118 M4302L probably benign Het
Flnb T C 14: 7,901,951 V938A probably damaging Het
Frmd4a T C 2: 4,604,092 Y928H probably damaging Het
Fyn C T 10: 39,511,982 T78M probably benign Het
Gdap2 A G 3: 100,201,995 T443A probably damaging Het
Gde1 A T 7: 118,695,060 F63L probably benign Het
Gjc3 A G 5: 137,957,940 S28P probably benign Het
Gm10250 G A 15: 5,120,991 probably null Het
Gm1141 T C X: 71,939,555 C378R possibly damaging Het
Hp1bp3 C T 4: 138,237,209 S348F probably damaging Het
Klhl23 T C 2: 69,833,966 V553A probably damaging Het
Lman2l G T 1: 36,424,864 S171* probably null Het
Lrp1b T C 2: 41,511,508 D378G probably damaging Het
Map3k11 T C 19: 5,690,815 L190P probably damaging Het
Mki67 T A 7: 135,696,459 Q2282L probably damaging Het
Mthfd2 T A 6: 83,309,008 I272F probably damaging Het
Myom1 A T 17: 71,045,755 D358V probably damaging Het
Nebl T A 2: 17,393,023 Q487H possibly damaging Het
Nebl T C 2: 17,390,926 probably benign Het
Nlrp2 T A 7: 5,322,418 N14Y possibly damaging Het
Olfr1090 T C 2: 86,753,887 M284V probably benign Het
Olfr304 T C 7: 86,386,306 Y118C probably damaging Het
Olfr339 T A 2: 36,422,287 D296E probably benign Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Olfr992 T A 2: 85,399,961 S191C probably damaging Het
Paxip1 C T 5: 27,744,185 probably benign Het
Pclo A G 5: 14,679,797 probably benign Het
Pld2 T G 11: 70,554,348 N591K probably benign Het
Plekha7 A G 7: 116,170,704 M276T probably damaging Het
Prss39 T A 1: 34,502,200 probably benign Het
Prtg A G 9: 72,809,716 Y113C probably damaging Het
Rab38 T A 7: 88,450,541 I88N probably damaging Het
Rbfox2 A G 15: 77,091,857 probably benign Het
Samd5 A G 10: 9,674,939 W9R probably damaging Het
Sec14l1 A T 11: 117,156,407 K637I possibly damaging Het
Sh2b1 A T 7: 126,471,448 D360E possibly damaging Het
Sh3bp4 A G 1: 89,145,314 N628S possibly damaging Het
Sim1 A T 10: 50,907,961 I104F probably damaging Het
Smcp T A 3: 92,584,520 T7S unknown Het
Sp4 A G 12: 118,300,816 probably benign Het
Tectb G T 19: 55,181,961 K81N probably damaging Het
Thbs4 G T 13: 92,754,410 H850N probably benign Het
Tiam1 T C 16: 89,897,754 M272V probably benign Het
Trav13-3 T A 14: 53,729,776 noncoding transcript Het
Ubap2l A T 3: 90,021,373 S478T possibly damaging Het
Vmn2r85 A G 10: 130,419,185 probably benign Het
Other mutations in Cped1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Cped1 APN 6 22215523 missense probably damaging 1.00
IGL00909:Cped1 APN 6 22122427 splice site probably benign
IGL01434:Cped1 APN 6 22017005 missense probably damaging 0.99
IGL01572:Cped1 APN 6 22051301 missense probably benign 0.00
IGL02063:Cped1 APN 6 22138702 missense probably damaging 0.98
IGL02216:Cped1 APN 6 22059945 missense probably damaging 1.00
IGL02257:Cped1 APN 6 22145607 missense possibly damaging 0.86
IGL02541:Cped1 APN 6 22120989 missense probably benign 0.00
IGL03008:Cped1 APN 6 22233602 missense probably benign 0.01
IGL03237:Cped1 APN 6 22233596 missense probably damaging 1.00
PIT4382001:Cped1 UTSW 6 22222450 nonsense probably null
PIT4812001:Cped1 UTSW 6 22122294 missense probably benign 0.02
R0048:Cped1 UTSW 6 22119602 missense probably benign 0.08
R0128:Cped1 UTSW 6 22121039 missense probably benign 0.00
R0267:Cped1 UTSW 6 22119476 missense probably damaging 0.99
R0374:Cped1 UTSW 6 22222546 splice site probably benign
R0482:Cped1 UTSW 6 22016958 missense probably benign 0.32
R0734:Cped1 UTSW 6 22085041 missense probably damaging 1.00
R1033:Cped1 UTSW 6 22016951 missense probably damaging 0.99
R1118:Cped1 UTSW 6 22237699 missense probably benign 0.19
R1181:Cped1 UTSW 6 22215562 missense probably damaging 0.99
R1300:Cped1 UTSW 6 22119553 missense probably benign 0.00
R1485:Cped1 UTSW 6 22132388 critical splice donor site probably null
R1507:Cped1 UTSW 6 22122261 missense probably damaging 1.00
R1830:Cped1 UTSW 6 22237728 missense probably damaging 1.00
R1879:Cped1 UTSW 6 22085015 splice site probably null
R1902:Cped1 UTSW 6 22120981 splice site probably null
R1991:Cped1 UTSW 6 22233927 missense probably damaging 1.00
R2020:Cped1 UTSW 6 22143964 missense probably benign 0.38
R2883:Cped1 UTSW 6 22143979 missense probably damaging 1.00
R3011:Cped1 UTSW 6 22088696 missense probably damaging 1.00
R4466:Cped1 UTSW 6 22123652 missense probably benign 0.29
R4668:Cped1 UTSW 6 22237653 missense probably benign 0.06
R4808:Cped1 UTSW 6 22088757 missense probably damaging 1.00
R5402:Cped1 UTSW 6 22143952 missense probably benign 0.05
R5417:Cped1 UTSW 6 22233580 missense probably null 0.01
R5741:Cped1 UTSW 6 22123621 missense probably benign 0.02
R5821:Cped1 UTSW 6 22138682 missense probably benign 0.00
R5977:Cped1 UTSW 6 22254608 missense probably damaging 1.00
R6255:Cped1 UTSW 6 22138715 splice site probably null
R6304:Cped1 UTSW 6 22016923 missense probably benign 0.14
R6416:Cped1 UTSW 6 22123649 missense probably damaging 1.00
R6444:Cped1 UTSW 6 21986931 missense probably benign 0.00
R6617:Cped1 UTSW 6 22215547 nonsense probably null
R6650:Cped1 UTSW 6 22233976 missense probably damaging 1.00
R7048:Cped1 UTSW 6 22119470 missense probably benign 0.36
R7083:Cped1 UTSW 6 22123580 missense probably benign 0.01
R7234:Cped1 UTSW 6 22254626 missense probably damaging 0.99
R7387:Cped1 UTSW 6 22059934 missense probably benign 0.01
R7493:Cped1 UTSW 6 22215513 missense probably damaging 1.00
X0022:Cped1 UTSW 6 21987046 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- AAATGGGGTCACCTCTGTTCTCGG -3'
(R):5'- ACAGATTCCCCACTTGTTAGGAGCC -3'

Sequencing Primer
(F):5'- AGAGAGAGGTGCTCATTCCC -3'
(R):5'- TCAGCCTGTACTGACTGCAA -3'
Posted On2013-06-12