Incidental Mutation 'R5476:Dgcr8'
ID501101
Institutional Source Beutler Lab
Gene Symbol Dgcr8
Ensembl Gene ENSMUSG00000022718
Gene NameDGCR8, microprocessor complex subunit
SynonymsGy1, D16H22S788E, D16Wis2, D16H22S1742E, Vo59c07, N41
MMRRC Submission 043037-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5476 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location18253948-18289246 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 18259979 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 597 (Y597N)
Ref Sequence ENSEMBL: ENSMUSP00000009321 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009321] [ENSMUST00000115633]
Predicted Effect probably damaging
Transcript: ENSMUST00000009321
AA Change: Y597N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000009321
Gene: ENSMUSG00000022718
AA Change: Y597N

DomainStartEndE-ValueType
low complexity region 165 176 N/A INTRINSIC
WW 302 334 7.26e-6 SMART
low complexity region 411 421 N/A INTRINSIC
DSRM 512 577 5.68e-10 SMART
DSRM 620 685 8.26e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000115633
SMART Domains Protein: ENSMUSP00000111296
Gene: ENSMUSG00000022718

DomainStartEndE-ValueType
low complexity region 165 176 N/A INTRINSIC
WW 302 334 7.26e-6 SMART
low complexity region 411 421 N/A INTRINSIC
DSRM 512 577 5.68e-10 SMART
DSRM 620 685 8.26e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144536
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152033
Predicted Effect probably benign
Transcript: ENSMUST00000232144
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232476
Coding Region Coverage
  • 1x: 98.4%
  • 3x: 97.4%
  • 10x: 95.5%
  • 20x: 91.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the microprocessor complex which mediates the biogenesis of microRNAs from the primary microRNA transcript. The encoded protein is a double-stranded RNA binding protein that functions as the non-catalytic subunit of the microprocessor complex. This protein is required for binding the double-stranded RNA substrate and facilitates cleavage of the RNA by the ribonuclease III protein, Drosha. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jun 2010]
PHENOTYPE: Mice heterozygous for a gene trap allele exhibit reduced dendritic spine number and dendritiic complexity along with abnormal prepulse inhibition and abnormal spatial working memory. Homozygous mice are embryonic lethal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh16a1 T G 7: 45,142,069 N71H possibly damaging Het
Alg5 T A 3: 54,746,598 S252T probably benign Het
Arhgap21 T C 2: 20,880,686 N560S probably benign Het
Ccdc96 A G 5: 36,485,637 D329G possibly damaging Het
Cep128 T C 12: 91,213,618 E917G probably damaging Het
Cpox G C 16: 58,678,725 V434L probably damaging Het
D5Ertd579e G T 5: 36,615,257 S598Y probably damaging Het
Ddx6 A G 9: 44,607,456 R22G possibly damaging Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Dock5 T C 14: 67,814,007 D671G possibly damaging Het
Dock6 A G 9: 21,809,589 S1707P probably damaging Het
Dopey2 A G 16: 93,773,913 probably null Het
Faim A G 9: 98,992,729 R110G probably damaging Het
Grm4 A G 17: 27,434,798 V726A probably benign Het
Hps1 T C 19: 42,769,602 probably null Het
Lefty1 T C 1: 180,937,698 M277T probably benign Het
Mmp9 A G 2: 164,952,494 M469V probably benign Het
Mroh4 A T 15: 74,611,661 I609N probably benign Het
Myl6b C T 10: 128,497,347 probably benign Het
Nt5m A G 11: 59,875,907 D208G probably damaging Het
Pard3b G T 1: 62,010,406 V108L probably benign Het
Pbp2 A G 6: 135,309,924 S142P probably benign Het
Pbrm1 T A 14: 31,032,519 D165E probably benign Het
Pde4b A G 4: 102,602,699 K577R probably benign Het
Phf21b A G 15: 84,787,265 M476T probably benign Het
Prr14l T C 5: 32,844,138 probably benign Het
Ralgapa2 A G 2: 146,447,436 V282A probably benign Het
Rif1 A G 2: 52,089,595 I430V probably damaging Het
Slc25a12 A G 2: 71,275,322 S623P probably benign Het
Smc1b A T 15: 85,086,151 I967N probably damaging Het
Snx13 A G 12: 35,106,820 probably null Het
Spata2 A T 2: 167,484,159 S247T probably damaging Het
Stpg2 T A 3: 139,243,138 Y232N probably benign Het
Tor3a G T 1: 156,673,567 S100R possibly damaging Het
Trappc8 A G 18: 20,865,108 F385S probably damaging Het
Uggt2 T A 14: 119,090,709 T134S probably benign Het
Vmn1r175 C T 7: 23,809,131 V24I possibly damaging Het
Wdr1 C T 5: 38,529,588 G278S probably damaging Het
Zfp157 T G 5: 138,457,181 V547G possibly damaging Het
Zfp442 A T 2: 150,408,159 C551S probably damaging Het
Other mutations in Dgcr8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01525:Dgcr8 APN 16 18283944 missense probably damaging 1.00
IGL01767:Dgcr8 APN 16 18278336 missense probably damaging 0.98
IGL02349:Dgcr8 APN 16 18280306 missense possibly damaging 0.67
IGL02834:Dgcr8 APN 16 18272759 missense probably benign 0.08
disneyland UTSW 16 18259623 missense probably damaging 1.00
R1558:Dgcr8 UTSW 16 18259588 missense probably damaging 1.00
R1587:Dgcr8 UTSW 16 18280291 missense probably damaging 1.00
R1656:Dgcr8 UTSW 16 18256713 missense probably benign 0.00
R1866:Dgcr8 UTSW 16 18258314 missense probably damaging 1.00
R1886:Dgcr8 UTSW 16 18278354 missense possibly damaging 0.95
R2144:Dgcr8 UTSW 16 18284256 missense probably damaging 1.00
R2145:Dgcr8 UTSW 16 18280230 missense probably benign 0.26
R3773:Dgcr8 UTSW 16 18256775 missense probably damaging 0.99
R4568:Dgcr8 UTSW 16 18280394 missense probably benign 0.14
R4783:Dgcr8 UTSW 16 18258310 nonsense probably null
R4784:Dgcr8 UTSW 16 18258310 nonsense probably null
R5138:Dgcr8 UTSW 16 18278077 missense probably damaging 0.99
R5276:Dgcr8 UTSW 16 18283771 missense probably benign 0.01
R5510:Dgcr8 UTSW 16 18277175 missense probably damaging 0.98
R5745:Dgcr8 UTSW 16 18280443 missense probably benign 0.01
R5771:Dgcr8 UTSW 16 18272768 missense probably benign 0.25
R6035:Dgcr8 UTSW 16 18258314 missense probably damaging 1.00
R6035:Dgcr8 UTSW 16 18258314 missense probably damaging 1.00
R6182:Dgcr8 UTSW 16 18280308 missense probably benign 0.00
R6190:Dgcr8 UTSW 16 18284410 missense probably damaging 0.97
R6633:Dgcr8 UTSW 16 18284182 missense possibly damaging 0.94
R6786:Dgcr8 UTSW 16 18283829 nonsense probably null
R7468:Dgcr8 UTSW 16 18259623 missense probably damaging 1.00
Z1176:Dgcr8 UTSW 16 18278318 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GGCTCTCCACACACTAATTTCAG -3'
(R):5'- GCAAAATTTCTCTCCCTGCAT -3'

Sequencing Primer
(F):5'- GTAACCCAGAGCTTCTGTGAC -3'
(R):5'- TTGTAGACTAGGCTGGCCTCAAAC -3'
Posted On2017-12-01