Incidental Mutation 'R0130:D630045J12Rik'
ID 50111
Institutional Source Beutler Lab
Gene Symbol D630045J12Rik
Ensembl Gene ENSMUSG00000063455
Gene Name RIKEN cDNA D630045J12 gene
Synonyms
MMRRC Submission 038415-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0130 (G1)
Quality Score 117
Status Validated (trace)
Chromosome 6
Chromosomal Location 38100109-38230944 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) A to T at 38126706 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000130121 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117556] [ENSMUST00000169256]
AlphaFold Q68FD9
Predicted Effect probably benign
Transcript: ENSMUST00000117556
SMART Domains Protein: ENSMUSP00000112939
Gene: ENSMUSG00000063455

DomainStartEndE-ValueType
low complexity region 190 203 N/A INTRINSIC
low complexity region 290 301 N/A INTRINSIC
low complexity region 414 431 N/A INTRINSIC
low complexity region 528 573 N/A INTRINSIC
low complexity region 581 598 N/A INTRINSIC
transmembrane domain 708 730 N/A INTRINSIC
Pfam:DUF3827 746 1412 N/A PFAM
low complexity region 1480 1500 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127925
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144973
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149557
Predicted Effect probably benign
Transcript: ENSMUST00000169256
SMART Domains Protein: ENSMUSP00000130121
Gene: ENSMUSG00000063455

DomainStartEndE-ValueType
signal peptide 1 45 N/A INTRINSIC
low complexity region 469 482 N/A INTRINSIC
low complexity region 569 580 N/A INTRINSIC
low complexity region 693 710 N/A INTRINSIC
low complexity region 807 852 N/A INTRINSIC
low complexity region 860 877 N/A INTRINSIC
transmembrane domain 987 1009 N/A INTRINSIC
Pfam:DUF3827 1026 1691 7.1e-301 PFAM
low complexity region 1759 1779 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.7%
  • 10x: 93.4%
  • 20x: 80.2%
Validation Efficiency 99% (84/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the UPF0606 family. This gene has been found to be fused to the BRAF oncogene in many cases of pilocytic astrocytoma. The fusion results from 2Mb tandem duplications at 7q34. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2012]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg8 A T 17: 84,994,094 (GRCm39) Y37F probably damaging Het
Ablim2 G A 5: 35,966,520 (GRCm39) probably benign Het
Anxa9 A G 3: 95,209,733 (GRCm39) S129P probably benign Het
Apol7c A G 15: 77,410,562 (GRCm39) I128T possibly damaging Het
Arfgef2 T G 2: 166,677,639 (GRCm39) I88S probably damaging Het
Arfip2 A G 7: 105,288,205 (GRCm39) probably benign Het
Atp5mf A T 5: 145,124,992 (GRCm39) probably benign Het
Atp7b C T 8: 22,518,188 (GRCm39) E205K possibly damaging Het
Atp8b5 T A 4: 43,369,715 (GRCm39) probably null Het
Cd22 A G 7: 30,569,389 (GRCm39) Y402H possibly damaging Het
Cd248 A G 19: 5,119,990 (GRCm39) T613A probably benign Het
Cdcp2 C T 4: 106,963,904 (GRCm39) probably benign Het
Cenpc1 A T 5: 86,194,405 (GRCm39) D120E probably benign Het
Chd3 T A 11: 69,250,656 (GRCm39) H691L probably damaging Het
Colec12 C T 18: 9,858,921 (GRCm39) P568L unknown Het
Cped1 T A 6: 22,121,038 (GRCm39) Y373N probably benign Het
Cr2 A T 1: 194,848,539 (GRCm39) V328D probably damaging Het
Ctnnd2 A T 15: 30,922,059 (GRCm39) E895V probably damaging Het
Dcdc2a A T 13: 25,371,655 (GRCm39) probably benign Het
Dync1h1 C A 12: 110,585,108 (GRCm39) T837K probably benign Het
Eif2ak3 C A 6: 70,858,716 (GRCm39) probably benign Het
Epb41l5 A C 1: 119,477,632 (GRCm39) V705G possibly damaging Het
Fat2 T A 11: 55,142,944 (GRCm39) M4302L probably benign Het
Flnb T C 14: 7,901,951 (GRCm38) V938A probably damaging Het
Frmd4a T C 2: 4,608,903 (GRCm39) Y928H probably damaging Het
Fyn C T 10: 39,387,978 (GRCm39) T78M probably benign Het
Gdap2 A G 3: 100,109,311 (GRCm39) T443A probably damaging Het
Gde1 A T 7: 118,294,283 (GRCm39) F63L probably benign Het
Gjc3 A G 5: 137,956,202 (GRCm39) S28P probably benign Het
Gm10250 G A 15: 5,150,473 (GRCm39) probably null Het
Hp1bp3 C T 4: 137,964,520 (GRCm39) S348F probably damaging Het
Klhl23 T C 2: 69,664,310 (GRCm39) V553A probably damaging Het
Lman2l G T 1: 36,463,945 (GRCm39) S171* probably null Het
Lrp1b T C 2: 41,401,520 (GRCm39) D378G probably damaging Het
Map3k11 T C 19: 5,740,843 (GRCm39) L190P probably damaging Het
Mki67 T A 7: 135,298,188 (GRCm39) Q2282L probably damaging Het
Mthfd2 T A 6: 83,285,990 (GRCm39) I272F probably damaging Het
Myom1 A T 17: 71,352,750 (GRCm39) D358V probably damaging Het
Nebl T C 2: 17,395,737 (GRCm39) probably benign Het
Nebl T A 2: 17,397,834 (GRCm39) Q487H possibly damaging Het
Nlrp2 T A 7: 5,325,417 (GRCm39) N14Y possibly damaging Het
Or14a258 T C 7: 86,035,514 (GRCm39) Y118C probably damaging Het
Or1j11 T A 2: 36,312,299 (GRCm39) D296E probably benign Het
Or2z8 C T 8: 72,812,244 (GRCm39) T240M probably damaging Het
Or5ak22 T A 2: 85,230,305 (GRCm39) S191C probably damaging Het
Or8k40 T C 2: 86,584,231 (GRCm39) M284V probably benign Het
Pasd1 T C X: 70,983,161 (GRCm39) C378R possibly damaging Het
Paxip1 C T 5: 27,949,183 (GRCm39) probably benign Het
Pclo A G 5: 14,729,811 (GRCm39) probably benign Het
Pld2 T G 11: 70,445,174 (GRCm39) N591K probably benign Het
Plekha7 A G 7: 115,769,939 (GRCm39) M276T probably damaging Het
Prss39 T A 1: 34,541,281 (GRCm39) probably benign Het
Prtg A G 9: 72,716,998 (GRCm39) Y113C probably damaging Het
Rab38 T A 7: 88,099,749 (GRCm39) I88N probably damaging Het
Rbfox2 A G 15: 76,976,057 (GRCm39) probably benign Het
Samd5 A G 10: 9,550,683 (GRCm39) W9R probably damaging Het
Sec14l1 A T 11: 117,047,233 (GRCm39) K637I possibly damaging Het
Sh2b1 A T 7: 126,070,620 (GRCm39) D360E possibly damaging Het
Sh3bp4 A G 1: 89,073,036 (GRCm39) N628S possibly damaging Het
Sim1 A T 10: 50,784,057 (GRCm39) I104F probably damaging Het
Smcp T A 3: 92,491,827 (GRCm39) T7S unknown Het
Sp4 A G 12: 118,264,551 (GRCm39) probably benign Het
Tectb G T 19: 55,170,393 (GRCm39) K81N probably damaging Het
Thbs4 G T 13: 92,890,918 (GRCm39) H850N probably benign Het
Tiam1 T C 16: 89,694,642 (GRCm39) M272V probably benign Het
Trav13-3 T A 14: 53,967,233 (GRCm39) noncoding transcript Het
Ubap2l A T 3: 89,928,680 (GRCm39) S478T possibly damaging Het
Vmn2r85 A G 10: 130,255,054 (GRCm39) probably benign Het
Other mutations in D630045J12Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00578:D630045J12Rik APN 6 38,171,865 (GRCm39) missense probably benign 0.03
IGL01089:D630045J12Rik APN 6 38,113,898 (GRCm39) missense probably benign
IGL01745:D630045J12Rik APN 6 38,168,655 (GRCm39) missense probably damaging 0.99
IGL02069:D630045J12Rik APN 6 38,161,007 (GRCm39) missense probably damaging 0.98
IGL02238:D630045J12Rik APN 6 38,173,329 (GRCm39) missense probably benign
IGL02496:D630045J12Rik APN 6 38,126,640 (GRCm39) missense probably damaging 1.00
IGL02675:D630045J12Rik APN 6 38,172,420 (GRCm39) missense possibly damaging 0.93
IGL03030:D630045J12Rik APN 6 38,126,648 (GRCm39) missense probably damaging 1.00
IGL03203:D630045J12Rik APN 6 38,145,156 (GRCm39) missense probably damaging 0.98
IGL03205:D630045J12Rik APN 6 38,124,194 (GRCm39) missense probably damaging 1.00
PIT4472001:D630045J12Rik UTSW 6 38,155,774 (GRCm39) missense probably damaging 1.00
PIT4687001:D630045J12Rik UTSW 6 38,172,036 (GRCm39) missense probably benign
R0021:D630045J12Rik UTSW 6 38,160,902 (GRCm39) nonsense probably null
R0021:D630045J12Rik UTSW 6 38,160,902 (GRCm39) nonsense probably null
R0128:D630045J12Rik UTSW 6 38,126,706 (GRCm39) splice site probably benign
R0206:D630045J12Rik UTSW 6 38,116,385 (GRCm39) missense probably damaging 0.99
R0208:D630045J12Rik UTSW 6 38,116,385 (GRCm39) missense probably damaging 0.99
R0347:D630045J12Rik UTSW 6 38,158,327 (GRCm39) missense probably damaging 0.97
R0396:D630045J12Rik UTSW 6 38,173,671 (GRCm39) missense possibly damaging 0.85
R0538:D630045J12Rik UTSW 6 38,168,628 (GRCm39) missense probably damaging 1.00
R0636:D630045J12Rik UTSW 6 38,173,713 (GRCm39) missense probably benign
R0842:D630045J12Rik UTSW 6 38,125,400 (GRCm39) missense probably damaging 1.00
R1120:D630045J12Rik UTSW 6 38,171,705 (GRCm39) missense probably damaging 0.96
R1323:D630045J12Rik UTSW 6 38,125,443 (GRCm39) missense probably damaging 1.00
R1323:D630045J12Rik UTSW 6 38,125,443 (GRCm39) missense probably damaging 1.00
R1412:D630045J12Rik UTSW 6 38,172,695 (GRCm39) missense probably benign 0.03
R1546:D630045J12Rik UTSW 6 38,167,590 (GRCm39) missense probably damaging 1.00
R1649:D630045J12Rik UTSW 6 38,158,366 (GRCm39) missense probably damaging 0.98
R1704:D630045J12Rik UTSW 6 38,116,362 (GRCm39) missense probably benign 0.14
R1969:D630045J12Rik UTSW 6 38,145,078 (GRCm39) missense probably damaging 1.00
R1971:D630045J12Rik UTSW 6 38,145,078 (GRCm39) missense probably damaging 1.00
R2182:D630045J12Rik UTSW 6 38,151,082 (GRCm39) critical splice donor site probably null
R2354:D630045J12Rik UTSW 6 38,135,026 (GRCm39) missense possibly damaging 0.88
R2926:D630045J12Rik UTSW 6 38,145,106 (GRCm39) missense probably damaging 1.00
R3768:D630045J12Rik UTSW 6 38,119,844 (GRCm39) missense probably damaging 1.00
R3886:D630045J12Rik UTSW 6 38,119,633 (GRCm39) missense possibly damaging 0.90
R4439:D630045J12Rik UTSW 6 38,171,696 (GRCm39) missense probably benign 0.07
R4688:D630045J12Rik UTSW 6 38,173,592 (GRCm39) missense possibly damaging 0.85
R4739:D630045J12Rik UTSW 6 38,172,971 (GRCm39) missense possibly damaging 0.76
R4748:D630045J12Rik UTSW 6 38,173,776 (GRCm39) missense possibly damaging 0.91
R4792:D630045J12Rik UTSW 6 38,125,275 (GRCm39) missense probably damaging 1.00
R4794:D630045J12Rik UTSW 6 38,171,420 (GRCm39) missense possibly damaging 0.90
R4947:D630045J12Rik UTSW 6 38,125,478 (GRCm39) missense probably damaging 1.00
R4959:D630045J12Rik UTSW 6 38,125,302 (GRCm39) missense possibly damaging 0.81
R4973:D630045J12Rik UTSW 6 38,125,302 (GRCm39) missense possibly damaging 0.81
R5261:D630045J12Rik UTSW 6 38,171,555 (GRCm39) missense probably benign
R5344:D630045J12Rik UTSW 6 38,135,163 (GRCm39) missense probably damaging 1.00
R5488:D630045J12Rik UTSW 6 38,173,782 (GRCm39) missense possibly damaging 0.85
R5489:D630045J12Rik UTSW 6 38,173,782 (GRCm39) missense possibly damaging 0.85
R5605:D630045J12Rik UTSW 6 38,168,699 (GRCm39) missense probably damaging 1.00
R5828:D630045J12Rik UTSW 6 38,173,302 (GRCm39) missense possibly damaging 0.47
R5831:D630045J12Rik UTSW 6 38,119,592 (GRCm39) missense possibly damaging 0.80
R5939:D630045J12Rik UTSW 6 38,171,904 (GRCm39) missense possibly damaging 0.70
R6021:D630045J12Rik UTSW 6 38,167,552 (GRCm39) missense probably benign 0.05
R6060:D630045J12Rik UTSW 6 38,107,799 (GRCm39) missense probably damaging 1.00
R6081:D630045J12Rik UTSW 6 38,119,633 (GRCm39) missense probably damaging 0.99
R6498:D630045J12Rik UTSW 6 38,124,132 (GRCm39) nonsense probably null
R6930:D630045J12Rik UTSW 6 38,135,151 (GRCm39) missense probably damaging 1.00
R7019:D630045J12Rik UTSW 6 38,171,570 (GRCm39) missense probably benign 0.12
R7156:D630045J12Rik UTSW 6 38,171,964 (GRCm39) missense possibly damaging 0.91
R7248:D630045J12Rik UTSW 6 38,145,198 (GRCm39) missense probably damaging 1.00
R7249:D630045J12Rik UTSW 6 38,113,885 (GRCm39) missense possibly damaging 0.95
R7250:D630045J12Rik UTSW 6 38,119,546 (GRCm39) missense possibly damaging 0.80
R7376:D630045J12Rik UTSW 6 38,151,238 (GRCm39) missense probably damaging 0.99
R7491:D630045J12Rik UTSW 6 38,119,601 (GRCm39) missense possibly damaging 0.89
R7552:D630045J12Rik UTSW 6 38,125,383 (GRCm39) missense probably damaging 0.99
R7560:D630045J12Rik UTSW 6 38,173,562 (GRCm39) missense possibly damaging 0.72
R7593:D630045J12Rik UTSW 6 38,172,429 (GRCm39) missense possibly damaging 0.93
R7624:D630045J12Rik UTSW 6 38,126,498 (GRCm39) missense probably damaging 1.00
R7654:D630045J12Rik UTSW 6 38,154,636 (GRCm39) missense probably damaging 1.00
R8159:D630045J12Rik UTSW 6 38,105,410 (GRCm39) missense probably damaging 0.99
R8167:D630045J12Rik UTSW 6 38,167,484 (GRCm39) critical splice donor site probably null
R8189:D630045J12Rik UTSW 6 38,135,106 (GRCm39) missense probably damaging 1.00
R8260:D630045J12Rik UTSW 6 38,119,846 (GRCm39) critical splice acceptor site probably null
R8270:D630045J12Rik UTSW 6 38,167,658 (GRCm39) nonsense probably null
R8331:D630045J12Rik UTSW 6 38,125,409 (GRCm39) missense probably damaging 1.00
R8363:D630045J12Rik UTSW 6 38,125,376 (GRCm39) missense probably damaging 1.00
R8365:D630045J12Rik UTSW 6 38,172,570 (GRCm39) missense probably benign
R8492:D630045J12Rik UTSW 6 38,167,525 (GRCm39) missense probably damaging 1.00
R8560:D630045J12Rik UTSW 6 38,126,649 (GRCm39) missense probably damaging 1.00
R8987:D630045J12Rik UTSW 6 38,173,898 (GRCm39) missense probably benign 0.11
R9052:D630045J12Rik UTSW 6 38,154,544 (GRCm39) missense probably damaging 1.00
R9264:D630045J12Rik UTSW 6 38,135,173 (GRCm39) missense probably benign 0.26
R9273:D630045J12Rik UTSW 6 38,167,512 (GRCm39) missense possibly damaging 0.88
R9431:D630045J12Rik UTSW 6 38,173,814 (GRCm39) missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- GGATGGGCTGCATGGCAATCAG -3'
(R):5'- CTTTCACCAGGGGCTGCAAACC -3'

Sequencing Primer
(F):5'- AGCTGGATCTTACTGGGGACC -3'
(R):5'- agtccgttctttctgcctc -3'
Posted On 2013-06-12