Mutagenetix > Incidental Mutations

Incidental Mutation 'R5479:Stat3'

501112

Institutional Source

Beutler Lab

Gene Symbol

Stat3

Ensembl Gene

ENSMUSG00000004040

Gene Name

signal transducer and activator of transcription 3

Synonyms

1110034C02Rik, Aprf

MMRRC Submission

043040-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5479 (G1)

Quality Score

212

Status

Not validated

Chromosome

Chromosomal Location

100885098-100939540 bp(-) (GRCm38)

Type of Mutation

unclassified

DNA Base Change (assembly)

T to C at 100889888 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000102980 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000004145] [ENSMUST00000092671] [ENSMUST00000103114] [ENSMUST00000107356] [ENSMUST00000107357] [ENSMUST00000127638] [ENSMUST00000138438]

Predicted Effect

probably benign
Transcript: ENSMUST00000004145

SMART Domains

Protein: ENSMUSP00000004145
Gene: ENSMUSG00000004043

Domain	Start	End	E-Value	Type
STAT_int	2	126	4.42e-62	SMART
Pfam:STAT_alpha	138	330	6.9e-58	PFAM
Pfam:STAT_bind	332	583	2.4e-101	PFAM
SH2	587	688	7.64e-6	SMART

Predicted Effect

silent
Transcript: ENSMUST00000092671

SMART Domains

Protein: ENSMUSP00000090342
Gene: ENSMUSG00000004040

Domain	Start	End	E-Value	Type
STAT_int	2	122	3.03e-60	SMART
Pfam:STAT_alpha	138	319	2.2e-62	PFAM
Pfam:STAT_bind	321	574	1.8e-130	PFAM
SH2	582	663	2.84e-1	SMART

Predicted Effect

silent
Transcript: ENSMUST00000103114

SMART Domains

Protein: ENSMUSP00000099403
Gene: ENSMUSG00000004040

Domain	Start	End	E-Value	Type
STAT_int	2	122	3.03e-60	SMART
Pfam:STAT_alpha	138	319	7.2e-62	PFAM
Pfam:STAT_bind	321	574	5.7e-130	PFAM
SH2	582	663	2.84e-1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000107356

SMART Domains

Protein: ENSMUSP00000102979
Gene: ENSMUSG00000004043

Domain	Start	End	E-Value	Type
STAT_int	2	126	4.42e-62	SMART
Pfam:STAT_alpha	138	330	6.9e-58	PFAM
Pfam:STAT_bind	332	583	2.4e-101	PFAM
SH2	587	688	7.64e-6	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000107357

SMART Domains

Protein: ENSMUSP00000102980
Gene: ENSMUSG00000004043

Domain	Start	End	E-Value	Type
STAT_int	2	126	4.42e-62	SMART
Pfam:STAT_alpha	141	330	4.5e-57	PFAM
Pfam:STAT_bind	332	582	1e-104	PFAM
SH2	587	688	1.55e-6	SMART
low complexity region	713	729	N/A	INTRINSIC

Predicted Effect

silent
Transcript: ENSMUST00000127638

SMART Domains

Protein: ENSMUSP00000120152
Gene: ENSMUSG00000004040

Domain	Start	End	E-Value	Type
STAT_int	2	122	3.03e-60	SMART
Pfam:STAT_alpha	141	319	6.8e-59	PFAM
Pfam:STAT_bind	321	573	2.5e-80	PFAM
SH2	582	663	2.84e-1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137093

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137367

Predicted Effect

silent
Transcript: ENSMUST00000138438

SMART Domains

Protein: ENSMUSP00000121677
Gene: ENSMUSG00000004040

Domain	Start	End	E-Value	Type
STAT_int	2	123	5.47e-35	SMART
coiled coil region	171	195	N/A	INTRINSIC
coiled coil region	243	265	N/A	INTRINSIC
Pfam:STAT_bind	295	548	9.2e-131	PFAM
SH2	556	637	2.84e-1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146971

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151544

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152601

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155972

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156645

Coding Region Coverage

1x: 98.4%
3x: 97.4%
10x: 95.4%
20x: 91.3%

Validation Efficiency

MGI Phenotype

FUNCTION: The protein encoded by this gene is a member of the STAT protein family. In response to cytokines and growth factors, STAT family members are phosphorylated by the receptor associated kinases, and then form homo- or heterodimers that translocate to the cell nucleus where they act as transcription activators. This protein is activated through phosphorylation in response to various cytokines and growth factors including IFNs, EGF, IL5, IL6, HGF, LIF and BMP2. This protein mediates the expression of a variety of genes in response to cell stimuli, and thus plays a key role in many cellular processes such as cell growth and apoptosis. The small GTPase Rac1 has been shown to bind and regulate the activity of this protein. PIAS3 protein is a specific inhibitor of this protein. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for targeted null mutations die at embryonic day 6.5-7.5. Conditional, tissue specific mutants are variably viable and show diverse defects including obesity, diabetes, thermal dysregulation and infertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acsl5	G	T	19: 55,280,462	C185F	probably damaging	Het
Adad2	C	A	8: 119,614,915	T185N	possibly damaging	Het
Apbb1	A	T	7: 105,565,025	V315E	probably damaging	Het
Arfrp1	T	C	2: 181,364,398	T32A	probably damaging	Het
B020004C17Rik	T	C	14: 57,016,542	S41P	probably benign	Het
Celsr3	T	C	9: 108,844,544		probably null	Het
Chd8	C	T	14: 52,215,195	G1289D	probably benign	Het
Ctrl	A	G	8: 105,933,040	F59S	probably damaging	Het
Cyp4v3	T	A	8: 45,310,206	D356V	probably benign	Het
Dgka	T	A	10: 128,729,672		probably null	Het
Dnah7b	T	C	1: 46,223,105	Y2043H	probably damaging	Het
Eya3	A	G	4: 132,672,933	T88A	possibly damaging	Het
Fat1	A	G	8: 45,036,875	D3608G	possibly damaging	Het
Fmo1	T	C	1: 162,850,224	T108A	probably damaging	Het
Frs3	A	G	17: 47,701,710	E114G	probably damaging	Het
Ftcd	A	T	10: 76,578,016	M85L	probably benign	Het
Ggnbp2	T	C	11: 84,854,343	S189G	probably benign	Het
Gm10251	C	T	14: 6,675,781	R35H	unknown	Het
Gnai2	T	G	9: 107,635,166	M18L	probably benign	Het
Gpx5	T	C	13: 21,292,635	Y9C	probably benign	Het
Grik1	C	A	16: 87,936,026	A668S	probably damaging	Het
Hectd4	A	T	5: 121,306,948	M83L	probably benign	Het
Klra9	T	C	6: 130,179,112	R227G	probably benign	Het
Maz	A	T	7: 127,025,688	V197D	possibly damaging	Het
Mbd5	T	C	2: 49,272,905	V241A	probably damaging	Het
Mdga2	C	T	12: 66,655,176	C417Y	probably damaging	Het
Mios	C	T	6: 8,215,314	T170I	probably benign	Het
Myh13	G	A	11: 67,348,822	A733T	probably damaging	Het
Ncam2	C	T	16: 81,434,878	R77*	probably null	Het
Nfs1	G	A	2: 156,128,502	T297I	probably damaging	Het
Nrbf2	A	G	10: 67,285,091		probably null	Het
Nrg1	T	C	8: 31,818,377	Y537C	probably damaging	Het
Olfr1208	T	C	2: 88,896,691	D302G	probably benign	Het
Onecut3	T	A	10: 80,514,022	L450Q	probably damaging	Het
Pard3	G	A	8: 127,370,355	R333Q	probably damaging	Het
Parp4	T	C	14: 56,624,095	F962L	probably benign	Het
Pilra	A	G	5: 137,836,056	S22P	possibly damaging	Het
Piwil4	T	C	9: 14,705,041	Y673C	probably damaging	Het
Plxna2	G	A	1: 194,793,873	D1134N	probably benign	Het
Pnpla7	T	C	2: 25,019,441	V681A	possibly damaging	Het
Ppfibp1	T	A	6: 147,030,150		probably null	Het
Ptprz1	C	T	6: 23,001,666	L1252F	probably benign	Het
Sptb	T	C	12: 76,599,851	E1999G	probably benign	Het
Usp25	T	C	16: 77,107,913	V789A	possibly damaging	Het
Zfp148	C	A	16: 33,497,219	Q712K	probably damaging	Het

Other mutations in Stat3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01720:Stat3	APN	11	100903658	missense	possibly damaging	0.77
IGL02289:Stat3	APN	11	100905894	missense	possibly damaging	0.82
IGL03183:Stat3	APN	11	100902756	missense	possibly damaging	0.71
Cunegonde	UTSW	11	100898633	missense	probably damaging	0.99
monostatos	UTSW	11	100895105	missense	probably damaging	1.00
Pangloss	UTSW	11	100893670	missense	possibly damaging	0.92
Stamatios	UTSW	11	100893230	missense	probably damaging	1.00
Voltaire	UTSW	11	100911267	missense	probably damaging	0.99
R0143:Stat3	UTSW	11	100895156	missense	possibly damaging	0.89
R0395:Stat3	UTSW	11	100889937	splice site	probably benign
R0487:Stat3	UTSW	11	100903643	missense	probably damaging	1.00
R0589:Stat3	UTSW	11	100908083	missense	probably damaging	0.97
R0800:Stat3	UTSW	11	100894155	splice site	probably benign
R1393:Stat3	UTSW	11	100888765	splice site	probably null
R1927:Stat3	UTSW	11	100894829	missense	probably damaging	1.00
R3819:Stat3	UTSW	11	100898633	missense	probably damaging	0.99
R4037:Stat3	UTSW	11	100893125	missense	probably damaging	1.00
R4391:Stat3	UTSW	11	100905552	intron	probably benign
R4598:Stat3	UTSW	11	100903674	missense	probably damaging	1.00
R4637:Stat3	UTSW	11	100893230	missense	probably damaging	1.00
R5909:Stat3	UTSW	11	100903730	missense	probably benign	0.00
R5930:Stat3	UTSW	11	100893670	missense	possibly damaging	0.92
R5944:Stat3	UTSW	11	100895105	missense	probably damaging	1.00
R6002:Stat3	UTSW	11	100903743	missense	probably benign	0.01
R6431:Stat3	UTSW	11	100889574	missense	possibly damaging	0.79
R6816:Stat3	UTSW	11	100911267	missense	probably damaging	0.99
R8071:Stat3	UTSW	11	100893981	missense	probably benign
R8466:Stat3	UTSW	11	100895098	missense	probably damaging	1.00
X0033:Stat3	UTSW	11	100893092	missense	probably benign
Z1176:Stat3	UTSW	11	100911278	missense	possibly damaging	0.89

Predicted Primers

PCR Primer
(F):5'- TCAAACTCTGGTCTCCAACAG -3'
(R):5'- CTGCAAGACTGGATGGCAAG -3'

Sequencing Primer
(F):5'- GTAACTCTCACCCCATGT -3'
(R):5'- GACAGCCCTAAGAGCTGGACTG -3'

Posted On

2017-12-01