Incidental Mutation 'R5479:Stat3'
ID501112
Institutional Source Beutler Lab
Gene Symbol Stat3
Ensembl Gene ENSMUSG00000004040
Gene Namesignal transducer and activator of transcription 3
Synonyms1110034C02Rik, Aprf
MMRRC Submission 043040-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5479 (G1)
Quality Score212
Status Not validated
Chromosome11
Chromosomal Location100885098-100939540 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 100889888 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000102980 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004145] [ENSMUST00000092671] [ENSMUST00000103114] [ENSMUST00000107356] [ENSMUST00000107357] [ENSMUST00000127638] [ENSMUST00000138438]
Predicted Effect probably benign
Transcript: ENSMUST00000004145
SMART Domains Protein: ENSMUSP00000004145
Gene: ENSMUSG00000004043

DomainStartEndE-ValueType
STAT_int 2 126 4.42e-62 SMART
Pfam:STAT_alpha 138 330 6.9e-58 PFAM
Pfam:STAT_bind 332 583 2.4e-101 PFAM
SH2 587 688 7.64e-6 SMART
Predicted Effect silent
Transcript: ENSMUST00000092671
SMART Domains Protein: ENSMUSP00000090342
Gene: ENSMUSG00000004040

DomainStartEndE-ValueType
STAT_int 2 122 3.03e-60 SMART
Pfam:STAT_alpha 138 319 2.2e-62 PFAM
Pfam:STAT_bind 321 574 1.8e-130 PFAM
SH2 582 663 2.84e-1 SMART
Predicted Effect silent
Transcript: ENSMUST00000103114
SMART Domains Protein: ENSMUSP00000099403
Gene: ENSMUSG00000004040

DomainStartEndE-ValueType
STAT_int 2 122 3.03e-60 SMART
Pfam:STAT_alpha 138 319 7.2e-62 PFAM
Pfam:STAT_bind 321 574 5.7e-130 PFAM
SH2 582 663 2.84e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107356
SMART Domains Protein: ENSMUSP00000102979
Gene: ENSMUSG00000004043

DomainStartEndE-ValueType
STAT_int 2 126 4.42e-62 SMART
Pfam:STAT_alpha 138 330 6.9e-58 PFAM
Pfam:STAT_bind 332 583 2.4e-101 PFAM
SH2 587 688 7.64e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107357
SMART Domains Protein: ENSMUSP00000102980
Gene: ENSMUSG00000004043

DomainStartEndE-ValueType
STAT_int 2 126 4.42e-62 SMART
Pfam:STAT_alpha 141 330 4.5e-57 PFAM
Pfam:STAT_bind 332 582 1e-104 PFAM
SH2 587 688 1.55e-6 SMART
low complexity region 713 729 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000127638
SMART Domains Protein: ENSMUSP00000120152
Gene: ENSMUSG00000004040

DomainStartEndE-ValueType
STAT_int 2 122 3.03e-60 SMART
Pfam:STAT_alpha 141 319 6.8e-59 PFAM
Pfam:STAT_bind 321 573 2.5e-80 PFAM
SH2 582 663 2.84e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137093
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137367
Predicted Effect silent
Transcript: ENSMUST00000138438
SMART Domains Protein: ENSMUSP00000121677
Gene: ENSMUSG00000004040

DomainStartEndE-ValueType
STAT_int 2 123 5.47e-35 SMART
coiled coil region 171 195 N/A INTRINSIC
coiled coil region 243 265 N/A INTRINSIC
Pfam:STAT_bind 295 548 9.2e-131 PFAM
SH2 556 637 2.84e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146971
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151544
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152601
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155972
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156645
Coding Region Coverage
  • 1x: 98.4%
  • 3x: 97.4%
  • 10x: 95.4%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the STAT protein family. In response to cytokines and growth factors, STAT family members are phosphorylated by the receptor associated kinases, and then form homo- or heterodimers that translocate to the cell nucleus where they act as transcription activators. This protein is activated through phosphorylation in response to various cytokines and growth factors including IFNs, EGF, IL5, IL6, HGF, LIF and BMP2. This protein mediates the expression of a variety of genes in response to cell stimuli, and thus plays a key role in many cellular processes such as cell growth and apoptosis. The small GTPase Rac1 has been shown to bind and regulate the activity of this protein. PIAS3 protein is a specific inhibitor of this protein. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for targeted null mutations die at embryonic day 6.5-7.5. Conditional, tissue specific mutants are variably viable and show diverse defects including obesity, diabetes, thermal dysregulation and infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl5 G T 19: 55,280,462 C185F probably damaging Het
Adad2 C A 8: 119,614,915 T185N possibly damaging Het
Apbb1 A T 7: 105,565,025 V315E probably damaging Het
Arfrp1 T C 2: 181,364,398 T32A probably damaging Het
B020004C17Rik T C 14: 57,016,542 S41P probably benign Het
Celsr3 T C 9: 108,844,544 probably null Het
Chd8 C T 14: 52,215,195 G1289D probably benign Het
Ctrl A G 8: 105,933,040 F59S probably damaging Het
Cyp4v3 T A 8: 45,310,206 D356V probably benign Het
Dgka T A 10: 128,729,672 probably null Het
Dnah7b T C 1: 46,223,105 Y2043H probably damaging Het
Eya3 A G 4: 132,672,933 T88A possibly damaging Het
Fat1 A G 8: 45,036,875 D3608G possibly damaging Het
Fmo1 T C 1: 162,850,224 T108A probably damaging Het
Frs3 A G 17: 47,701,710 E114G probably damaging Het
Ftcd A T 10: 76,578,016 M85L probably benign Het
Ggnbp2 T C 11: 84,854,343 S189G probably benign Het
Gm10251 C T 14: 6,675,781 R35H unknown Het
Gnai2 T G 9: 107,635,166 M18L probably benign Het
Gpx5 T C 13: 21,292,635 Y9C probably benign Het
Grik1 C A 16: 87,936,026 A668S probably damaging Het
Hectd4 A T 5: 121,306,948 M83L probably benign Het
Klra9 T C 6: 130,179,112 R227G probably benign Het
Maz A T 7: 127,025,688 V197D possibly damaging Het
Mbd5 T C 2: 49,272,905 V241A probably damaging Het
Mdga2 C T 12: 66,655,176 C417Y probably damaging Het
Mios C T 6: 8,215,314 T170I probably benign Het
Myh13 G A 11: 67,348,822 A733T probably damaging Het
Ncam2 C T 16: 81,434,878 R77* probably null Het
Nfs1 G A 2: 156,128,502 T297I probably damaging Het
Nrbf2 A G 10: 67,285,091 probably null Het
Nrg1 T C 8: 31,818,377 Y537C probably damaging Het
Olfr1208 T C 2: 88,896,691 D302G probably benign Het
Onecut3 T A 10: 80,514,022 L450Q probably damaging Het
Pard3 G A 8: 127,370,355 R333Q probably damaging Het
Parp4 T C 14: 56,624,095 F962L probably benign Het
Pilra A G 5: 137,836,056 S22P possibly damaging Het
Piwil4 T C 9: 14,705,041 Y673C probably damaging Het
Plxna2 G A 1: 194,793,873 D1134N probably benign Het
Pnpla7 T C 2: 25,019,441 V681A possibly damaging Het
Ppfibp1 T A 6: 147,030,150 probably null Het
Ptprz1 C T 6: 23,001,666 L1252F probably benign Het
Sptb T C 12: 76,599,851 E1999G probably benign Het
Usp25 T C 16: 77,107,913 V789A possibly damaging Het
Zfp148 C A 16: 33,497,219 Q712K probably damaging Het
Other mutations in Stat3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01720:Stat3 APN 11 100903658 missense possibly damaging 0.77
IGL02289:Stat3 APN 11 100905894 missense possibly damaging 0.82
IGL03183:Stat3 APN 11 100902756 missense possibly damaging 0.71
Cunegonde UTSW 11 100898633 missense probably damaging 0.99
monostatos UTSW 11 100895105 missense probably damaging 1.00
Pangloss UTSW 11 100893670 missense possibly damaging 0.92
Stamatios UTSW 11 100893230 missense probably damaging 1.00
Voltaire UTSW 11 100911267 missense probably damaging 0.99
R0143:Stat3 UTSW 11 100895156 missense possibly damaging 0.89
R0395:Stat3 UTSW 11 100889937 splice site probably benign
R0487:Stat3 UTSW 11 100903643 missense probably damaging 1.00
R0589:Stat3 UTSW 11 100908083 missense probably damaging 0.97
R0800:Stat3 UTSW 11 100894155 splice site probably benign
R1393:Stat3 UTSW 11 100888765 splice site probably null
R1927:Stat3 UTSW 11 100894829 missense probably damaging 1.00
R3819:Stat3 UTSW 11 100898633 missense probably damaging 0.99
R4037:Stat3 UTSW 11 100893125 missense probably damaging 1.00
R4391:Stat3 UTSW 11 100905552 intron probably benign
R4598:Stat3 UTSW 11 100903674 missense probably damaging 1.00
R4637:Stat3 UTSW 11 100893230 missense probably damaging 1.00
R5909:Stat3 UTSW 11 100903730 missense probably benign 0.00
R5930:Stat3 UTSW 11 100893670 missense possibly damaging 0.92
R5944:Stat3 UTSW 11 100895105 missense probably damaging 1.00
R6002:Stat3 UTSW 11 100903743 missense probably benign 0.01
R6431:Stat3 UTSW 11 100889574 missense possibly damaging 0.79
R6816:Stat3 UTSW 11 100911267 missense probably damaging 0.99
R8071:Stat3 UTSW 11 100893981 missense probably benign
R8466:Stat3 UTSW 11 100895098 missense probably damaging 1.00
X0033:Stat3 UTSW 11 100893092 missense probably benign
Z1176:Stat3 UTSW 11 100911278 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- TCAAACTCTGGTCTCCAACAG -3'
(R):5'- CTGCAAGACTGGATGGCAAG -3'

Sequencing Primer
(F):5'- GTAACTCTCACCCCATGT -3'
(R):5'- GACAGCCCTAAGAGCTGGACTG -3'
Posted On2017-12-01