Incidental Mutation 'R5481:Ntsr1'
ID501113
Institutional Source Beutler Lab
Gene Symbol Ntsr1
Ensembl Gene ENSMUSG00000027568
Gene Nameneurotensin receptor 1
SynonymsNtsr1, NTR1, NTR-1, NT-1R
MMRRC Submission 043042-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R5481 (G1)
Quality Score130
Status Not validated
Chromosome2
Chromosomal Location180499976-180544980 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 180541520 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 341 (T341M)
Ref Sequence ENSEMBL: ENSMUSP00000127548 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029084] [ENSMUST00000170448]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029084
AA Change: T341M

PolyPhen 2 Score 0.792 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000029084
Gene: ENSMUSG00000027568
AA Change: T341M

DomainStartEndE-ValueType
low complexity region 31 49 N/A INTRINSIC
Pfam:7tm_1 80 369 7.5e-55 PFAM
Pfam:7TM_GPCR_Srv 82 386 1e-8 PFAM
low complexity region 392 398 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000170448
AA Change: T341M

PolyPhen 2 Score 0.792 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000127548
Gene: ENSMUSG00000027568
AA Change: T341M

DomainStartEndE-ValueType
low complexity region 31 49 N/A INTRINSIC
Pfam:7tm_4 70 283 6.7e-9 PFAM
Pfam:7tm_1 80 369 2e-51 PFAM
Pfam:7TM_GPCR_Srv 83 386 1.8e-8 PFAM
low complexity region 392 398 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 97.6%
  • 10x: 95.1%
  • 20x: 90.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Neurotensin receptor 1 belongs to the large superfamily of G-protein coupled receptors. NTSR1 mediates the multiple functions of neurotensin, such as hypotension, hyperglycemia, hypothermia, antinociception, and regulation of intestinal motility and secretion. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice deficient for this marker have normal baseline prepulse inhibition responses and acoustic startle responses. Mice are heavier, eat more, and have lower body temperatures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522H14Rik A G 4: 109,505,562 S187P probably damaging Het
Aass C A 6: 23,113,476 V282L probably benign Het
Adh6a G T 3: 138,325,958 V204F probably damaging Het
Aspm A G 1: 139,457,061 K148E possibly damaging Het
Atp12a A T 14: 56,373,389 D330V possibly damaging Het
Barhl1 A G 2: 28,915,340 Y114H probably damaging Het
BC106179 T A 16: 23,224,168 probably benign Het
Cabin1 A G 10: 75,735,066 L792P probably benign Het
Calcoco2 A G 11: 96,107,543 V18A probably damaging Het
Chpf2 A T 5: 24,589,342 H170L probably damaging Het
Chrna1 T A 2: 73,566,926 I340F possibly damaging Het
Ckap5 A T 2: 91,572,447 I690F possibly damaging Het
Col10a1 A G 10: 34,395,664 H544R probably benign Het
Cyp2b19 A C 7: 26,766,821 T350P probably damaging Het
Dgkq A G 5: 108,648,810 probably null Het
Dnah1 A G 14: 31,308,871 V443A possibly damaging Het
Erbb3 T C 10: 128,572,480 D855G probably damaging Het
Fam3c T C 6: 22,321,358 D138G probably benign Het
Fen1 A G 19: 10,200,658 C141R probably damaging Het
Flnc G A 6: 29,441,217 G390D probably damaging Het
Fnip1 C A 11: 54,502,644 D635E probably benign Het
Fry A T 5: 150,260,319 L17F probably benign Het
Fsip2 T C 2: 82,979,886 I2183T probably benign Het
Gfpt1 T A 6: 87,050,969 I19N probably damaging Het
Gm9774 A G 3: 92,429,351 S15P possibly damaging Het
Hus1b T C 13: 30,946,959 D239G probably benign Het
Kif1a T C 1: 93,060,244 K546R probably benign Het
Kmt2d A G 15: 98,862,005 V1124A unknown Het
Krtap16-1 A G 11: 99,985,327 I417T probably damaging Het
Manba A T 3: 135,524,556 N297Y possibly damaging Het
Mblac1 A G 5: 138,194,816 D140G probably damaging Het
Mlh1 T C 9: 111,229,837 probably null Het
Morc1 T A 16: 48,561,485 probably null Het
Morc3 C A 16: 93,862,655 P449Q probably damaging Het
Mtr T C 13: 12,188,155 probably null Het
Mylk T A 16: 34,921,604 C829S probably benign Het
Myo1d A G 11: 80,663,095 I520T possibly damaging Het
Ncam2 C T 16: 81,434,878 R77* probably null Het
Nos1 A T 5: 117,867,754 I180F probably benign Het
Olfr916 A T 9: 38,657,620 F257L probably benign Het
P2rx7 A G 5: 122,680,820 D435G possibly damaging Het
Peli2 C A 14: 48,252,633 N136K probably damaging Het
Pigt C A 2: 164,506,422 P429H probably damaging Het
Pik3r2 T C 8: 70,769,764 I515V probably benign Het
Pkhd1l1 A G 15: 44,558,646 Y3104C probably damaging Het
Ppp1r16a A C 15: 76,691,021 E43A probably damaging Het
Ptpn18 T C 1: 34,471,663 L260P possibly damaging Het
Scaf11 A T 15: 96,420,617 S355R probably damaging Het
Sema4a A T 3: 88,453,040 Y77* probably null Het
Serpinb9b T C 13: 33,038,093 V230A possibly damaging Het
Sfswap T A 5: 129,514,818 S300T probably damaging Het
Slc22a30 T C 19: 8,336,837 N495S probably benign Het
Srcap G A 7: 127,532,197 G836D probably damaging Het
Stard4 A C 18: 33,205,245 C137W probably benign Het
Stat6 A G 10: 127,647,826 probably null Het
Steap3 T C 1: 120,241,724 D243G probably benign Het
Taf1c A G 8: 119,599,240 S628P probably damaging Het
Unkl C T 17: 25,201,172 Q13* probably null Het
Usp38 A G 8: 80,993,323 S426P possibly damaging Het
Vmn2r8 T C 5: 108,801,770 T404A probably benign Het
Washc1 T C 17: 66,118,865 V425A probably benign Het
Zfyve9 A G 4: 108,644,349 I590T probably damaging Het
Other mutations in Ntsr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01088:Ntsr1 APN 2 180542542 missense probably damaging 0.99
IGL01765:Ntsr1 APN 2 180538717 missense possibly damaging 0.56
IGL02137:Ntsr1 APN 2 180538835 critical splice donor site probably null
IGL02321:Ntsr1 APN 2 180538834 critical splice donor site probably null
IGL03349:Ntsr1 APN 2 180500502 missense probably benign
R0482:Ntsr1 UTSW 2 180501056 missense possibly damaging 0.54
R0542:Ntsr1 UTSW 2 180542581 missense probably damaging 1.00
R1081:Ntsr1 UTSW 2 180538756 missense probably benign 0.14
R1241:Ntsr1 UTSW 2 180500601 missense probably damaging 1.00
R1540:Ntsr1 UTSW 2 180542647 missense probably damaging 0.99
R3718:Ntsr1 UTSW 2 180542706 missense probably benign 0.00
R4206:Ntsr1 UTSW 2 180500752 missense probably damaging 1.00
R5703:Ntsr1 UTSW 2 180500433 missense probably damaging 0.98
R5975:Ntsr1 UTSW 2 180500788 missense probably damaging 1.00
R6643:Ntsr1 UTSW 2 180500926 missense probably damaging 1.00
R6754:Ntsr1 UTSW 2 180542683 missense probably benign 0.00
R7295:Ntsr1 UTSW 2 180500932 missense probably damaging 1.00
R7316:Ntsr1 UTSW 2 180500752 missense probably damaging 1.00
R7765:Ntsr1 UTSW 2 180538817 missense probably damaging 0.99
R7822:Ntsr1 UTSW 2 180538690 missense probably damaging 1.00
R8087:Ntsr1 UTSW 2 180500172 unclassified probably benign
R8555:Ntsr1 UTSW 2 180538677 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- CTCAGGATGCCACCTTTGTC -3'
(R):5'- CCTGGAGTAGCTATGACCAAAAG -3'

Sequencing Primer
(F):5'- GTCTTCCATGGCTCAGGATGC -3'
(R):5'- GAACCTTCAGCTCTGACATAAATG -3'
Posted On2017-12-01