Incidental Mutation 'R5492:Ngdn'
ID501117
Institutional Source Beutler Lab
Gene Symbol Ngdn
Ensembl Gene ENSMUSG00000022204
Gene Nameneuroguidin, EIF4E binding protein
Synonyms1500001L15Rik, Ngd, neuroguidin
MMRRC Submission 043053-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5492 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location55015454-55024137 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 55023052 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 239 (V239A)
Ref Sequence ENSEMBL: ENSMUSP00000022815 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022815]
Predicted Effect probably benign
Transcript: ENSMUST00000022815
AA Change: V239A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000022815
Gene: ENSMUSG00000022204
AA Change: V239A

DomainStartEndE-ValueType
Pfam:Sas10_Utp3 18 98 1.3e-18 PFAM
low complexity region 142 170 N/A INTRINSIC
low complexity region 296 314 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226258
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226658
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227833
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.1%
  • 10x: 94.5%
  • 20x: 89.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Neuroguidin is an EIF4E (MIM 133440)-binding protein that interacts with CPEB (MIM 607342) and functions as a translational regulatory protein during development of the vertebrate nervous system (Jung et al., 2006 [PubMed 16705177]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik C T 1: 11,545,207 R135C probably damaging Het
Abcd2 A G 15: 91,188,973 Y328H probably benign Het
Abcg4 T C 9: 44,278,058 T381A probably benign Het
Adamts12 A G 15: 11,336,298 N1490D probably benign Het
Aldh18a1 C T 19: 40,551,290 R747Q probably damaging Het
Armc8 G T 9: 99,527,131 C169* probably null Het
Birc6 A C 17: 74,670,374 N4388T probably damaging Het
Bsn G A 9: 108,112,515 P2013S probably damaging Het
Cdc16 A G 8: 13,763,915 probably null Het
Cmtr1 T A 17: 29,690,342 F408L probably damaging Het
Col4a2 C T 8: 11,438,608 R1104W possibly damaging Het
Drg2 A C 11: 60,461,596 H208P probably damaging Het
Frem3 A T 8: 80,612,677 D533V probably damaging Het
Gm9930 T A 10: 9,534,593 noncoding transcript Het
Haus5 A G 7: 30,658,955 V305A possibly damaging Het
Hint3 C A 10: 30,618,249 R30L probably benign Het
Hltf T A 3: 20,098,067 probably null Het
Hmcn2 T A 2: 31,420,306 L3304Q probably benign Het
Hspa2 A G 12: 76,404,534 M1V probably null Het
Htr5b T C 1: 121,527,658 T178A possibly damaging Het
Ighv1-11 A G 12: 114,612,464 S44P probably damaging Het
Larp1b C T 3: 40,969,899 R104W probably damaging Het
Map3k2 A G 18: 32,228,136 T550A probably damaging Het
Map4 T A 9: 110,052,382 S105T possibly damaging Het
Mgam T C 6: 40,756,363 C691R probably damaging Het
Mms19 A G 19: 41,955,831 I310T possibly damaging Het
Myh2 A C 11: 67,180,875 K506T probably benign Het
Plin1 G A 7: 79,725,712 R151* probably null Het
Rbpjl GCC GC 2: 164,414,410 probably null Het
Rdh16f2 G T 10: 127,866,754 E67* probably null Het
Slc25a36 A C 9: 97,100,206 C25W probably damaging Het
Stk31 G A 6: 49,398,243 A49T probably damaging Het
Tigar T A 6: 127,089,204 T124S possibly damaging Het
Tsn A G 1: 118,304,713 V144A probably damaging Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Zfp943 T A 17: 21,993,075 C381S probably damaging Het
Zfyve19 A T 2: 119,209,114 probably benign Het
Other mutations in Ngdn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00924:Ngdn APN 14 55023169 missense probably damaging 0.99
IGL01301:Ngdn APN 14 55017114 missense probably benign 0.15
IGL02350:Ngdn APN 14 55021936 missense probably damaging 1.00
IGL02357:Ngdn APN 14 55021936 missense probably damaging 1.00
ANU18:Ngdn UTSW 14 55017114 missense probably benign 0.15
PIT4651001:Ngdn UTSW 14 55016200 missense probably benign 0.05
R2062:Ngdn UTSW 14 55022107 missense possibly damaging 0.93
R2251:Ngdn UTSW 14 55023395 critical splice donor site probably null
R5167:Ngdn UTSW 14 55022199 nonsense probably null
R6174:Ngdn UTSW 14 55022099 missense probably benign 0.38
R6712:Ngdn UTSW 14 55016188 missense probably benign 0.18
R7866:Ngdn UTSW 14 55021097 missense probably damaging 1.00
R8303:Ngdn UTSW 14 55023145 missense probably benign 0.01
X0025:Ngdn UTSW 14 55021915 missense possibly damaging 0.71
Z1177:Ngdn UTSW 14 55021944 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- ATTGATGTGTGCGCATCCTG -3'
(R):5'- CCCGGGCTTTCTATATGAAGCC -3'

Sequencing Primer
(F):5'- CATCCTGGGGACTCTGGATGAG -3'
(R):5'- TCTATATGAAGCCCACGTGTG -3'
Posted On2017-12-01