Incidental Mutation 'R5308:Ces1b'
ID501118
Institutional Source Beutler Lab
Gene Symbol Ces1b
Ensembl Gene ENSMUSG00000078964
Gene Namecarboxylesterase 1B
SynonymsGm5158
MMRRC Submission 042891-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R5308 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location93056728-93080017 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 93067017 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 315 (K315E)
Ref Sequence ENSEMBL: ENSMUSP00000105210 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109582]
Predicted Effect probably benign
Transcript: ENSMUST00000109582
AA Change: K315E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000105210
Gene: ENSMUSG00000078964
AA Change: K315E

DomainStartEndE-ValueType
Pfam:COesterase 1 547 7.6e-168 PFAM
Pfam:Abhydrolase_3 136 245 8.5e-11 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 97.7%
  • 10x: 95.4%
  • 20x: 91.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik C G 3: 124,406,350 G531A probably damaging Het
2410089E03Rik G A 15: 8,260,690 probably null Het
4921504E06Rik T C 2: 19,524,081 D163G probably damaging Het
4931406P16Rik T A 7: 34,245,755 K355* probably null Het
Abcd4 C T 12: 84,603,293 probably null Het
Alg9 T C 9: 50,822,711 S570P possibly damaging Het
Angptl3 C A 4: 99,034,486 H255N probably benign Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Cdc37 A T 9: 21,140,764 D326E probably benign Het
Cdk13 T C 13: 17,772,313 K6R probably damaging Het
Cfap61 G A 2: 146,109,988 G190S probably damaging Het
Ckap4 T C 10: 84,528,374 E275G probably benign Het
Csf3r A G 4: 126,035,344 D349G probably benign Het
Cyp2d37-ps T C 15: 82,689,811 noncoding transcript Het
Dmbt1 T A 7: 131,041,021 C190S probably damaging Het
Dnah11 A G 12: 118,085,680 F1670L possibly damaging Het
Dnah5 A T 15: 28,229,651 I144F possibly damaging Het
Eno2 C A 6: 124,767,093 V84L probably damaging Het
Ercc4 G T 16: 13,130,164 R325L probably damaging Het
Fam71e1 T C 7: 44,500,182 V109A probably damaging Het
Fcgr2b T G 1: 170,965,710 Q250P probably benign Het
Gcfc2 T C 6: 81,943,543 probably null Het
Glb1l2 C T 9: 26,764,759 G509D probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Grn A G 11: 102,436,192 N160D possibly damaging Het
Hexdc T A 11: 121,222,269 V510D probably damaging Het
Igfbp1 G A 11: 7,199,919 probably null Het
Itga11 T A 9: 62,755,769 M589K probably benign Het
Itpr1 A T 6: 108,356,511 S51C probably damaging Het
Klra3 T C 6: 130,334,307 probably null Het
Mad2l1 T C 6: 66,537,691 probably null Het
Matn3 CGGGGCTCGGGGGC CGGGGC 12: 8,952,308 probably null Het
Myo9a T A 9: 59,863,961 Y939N probably damaging Het
Nxpe3 C T 16: 55,866,471 S58N probably benign Het
Olfr1195 T C 2: 88,683,405 E109G probably benign Het
Olfr1295 C T 2: 111,564,554 A297T probably damaging Het
Olfr345 T A 2: 36,640,694 Y218* probably null Het
Olfr402 T A 11: 74,155,571 M139K probably damaging Het
Paics T C 5: 76,956,632 S35P probably damaging Het
Pcnt A C 10: 76,356,325 Y2717* probably null Het
Pifo T C 3: 106,001,103 T107A probably benign Het
Plekho2 T A 9: 65,558,675 N144Y probably damaging Het
Plscr5 T C 9: 92,198,512 F17S possibly damaging Het
Prrc2a C T 17: 35,161,047 R192H unknown Het
Rbm27 T A 18: 42,327,210 M735K probably damaging Het
Rfc1 T A 5: 65,279,461 K625N probably damaging Het
Ric8b T A 10: 84,947,747 F156L probably benign Het
Romo1 C A 2: 156,144,553 A32E possibly damaging Het
Rpl26 T A 11: 68,904,458 Y135N probably damaging Het
Sacs T C 14: 61,192,400 V636A probably benign Het
Scyl2 A T 10: 89,642,007 I710N probably benign Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc4a1 T A 11: 102,359,077 I154F probably damaging Het
Snx11 A G 11: 96,770,709 S157P probably damaging Het
Snx18 G A 13: 113,616,847 Q517* probably null Het
Stard4 G T 18: 33,203,625 N212K probably damaging Het
Strn3 A G 12: 51,629,385 Y454H probably damaging Het
Stx17 A T 4: 48,182,851 probably benign Het
Tas2r121 G A 6: 132,700,517 T164I possibly damaging Het
Tbc1d8 T C 1: 39,389,409 Y485C probably damaging Het
Tmem45b T C 9: 31,429,084 M8V probably damaging Het
Usp28 T C 9: 49,037,201 F844L probably damaging Het
Usp32 T A 11: 85,017,718 N1054I probably benign Het
Xpa T A 4: 46,185,659 E106D probably benign Het
Zfp85 C T 13: 67,748,855 C366Y probably damaging Het
Other mutations in Ces1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01406:Ces1b APN 8 93071994 missense probably damaging 0.98
IGL01939:Ces1b APN 8 93079431 missense probably damaging 1.00
IGL02314:Ces1b APN 8 93064896 missense possibly damaging 0.95
IGL02338:Ces1b APN 8 93057047 missense possibly damaging 0.77
IGL02647:Ces1b APN 8 93057044 missense probably benign 0.00
IGL02833:Ces1b APN 8 93079410 missense probably damaging 1.00
IGL03038:Ces1b APN 8 93067052 missense probably benign
IGL03149:Ces1b APN 8 93064874 splice site probably benign
FR4548:Ces1b UTSW 8 93068092 missense probably null
IGL02802:Ces1b UTSW 8 93056966 missense possibly damaging 0.64
R0382:Ces1b UTSW 8 93076052 splice site probably benign
R0893:Ces1b UTSW 8 93079428 missense probably benign 0.11
R0959:Ces1b UTSW 8 93068147 missense probably damaging 1.00
R1386:Ces1b UTSW 8 93068077 missense probably benign 0.02
R1440:Ces1b UTSW 8 93068108 missense probably damaging 0.97
R1667:Ces1b UTSW 8 93056904 missense possibly damaging 0.75
R2113:Ces1b UTSW 8 93068155 missense probably benign
R2193:Ces1b UTSW 8 93079877 missense probably benign 0.00
R2508:Ces1b UTSW 8 93073341 missense possibly damaging 0.75
R4656:Ces1b UTSW 8 93057414 missense probably damaging 0.96
R4776:Ces1b UTSW 8 93063030 missense possibly damaging 0.92
R5108:Ces1b UTSW 8 93071913 missense probably damaging 1.00
R5117:Ces1b UTSW 8 93073209 critical splice donor site probably null
R5381:Ces1b UTSW 8 93065019 missense probably benign 0.02
R5392:Ces1b UTSW 8 93071962 missense probably damaging 0.98
R5614:Ces1b UTSW 8 93068208 missense probably benign 0.00
R5816:Ces1b UTSW 8 93073262 missense probably benign 0.05
R6554:Ces1b UTSW 8 93064991 missense probably benign 0.03
R6576:Ces1b UTSW 8 93056919 missense probably benign 0.06
R6601:Ces1b UTSW 8 93079481 missense probably benign
R6662:Ces1b UTSW 8 93064069 missense probably benign 0.33
R6753:Ces1b UTSW 8 93067020 nonsense probably null
R6904:Ces1b UTSW 8 93060410 missense probably damaging 0.96
R7267:Ces1b UTSW 8 93079504 missense possibly damaging 0.58
R7371:Ces1b UTSW 8 93057354 critical splice donor site probably null
R7396:Ces1b UTSW 8 93063129 missense probably benign 0.00
X0024:Ces1b UTSW 8 93063017 missense probably benign
Z1088:Ces1b UTSW 8 93064966 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TCCTTGCACCATCTCAGGAC -3'
(R):5'- TCAATTATGGTCCTAGGATAGCCATC -3'

Sequencing Primer
(F):5'- CCATCTCAGGACCTAGTTTGTATAG -3'
(R):5'- ACACTGGATCATTCTTCACATAAC -3'
Posted On2017-12-01