Incidental Mutation 'R0130:Or2z8'
ID 50112
Institutional Source Beutler Lab
Gene Symbol Or2z8
Ensembl Gene ENSMUSG00000069998
Gene Name olfactory receptor family 2 subfamily Z member 8
Synonyms MOR282-1, GA_x6K02T2NUPS-191522-192466, Olfr372
MMRRC Submission 038415-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.176) question?
Stock # R0130 (G1)
Quality Score 225
Status Validated (trace)
Chromosome 8
Chromosomal Location 72811504-72812519 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 72812244 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Methionine at position 240 (T240M)
Ref Sequence ENSEMBL: ENSMUSP00000149288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093434] [ENSMUST00000215324]
AlphaFold Q7TRY2
Predicted Effect probably damaging
Transcript: ENSMUST00000093434
AA Change: T240M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132724
Gene: ENSMUSG00000069998
AA Change: T240M

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2e-57 PFAM
Pfam:7TM_GPCR_Srsx 35 221 1.1e-7 PFAM
Pfam:7tm_1 41 290 6.4e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215324
AA Change: T240M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.7%
  • 10x: 93.4%
  • 20x: 80.2%
Validation Efficiency 99% (84/85)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg8 A T 17: 84,994,094 (GRCm39) Y37F probably damaging Het
Ablim2 G A 5: 35,966,520 (GRCm39) probably benign Het
Anxa9 A G 3: 95,209,733 (GRCm39) S129P probably benign Het
Apol7c A G 15: 77,410,562 (GRCm39) I128T possibly damaging Het
Arfgef2 T G 2: 166,677,639 (GRCm39) I88S probably damaging Het
Arfip2 A G 7: 105,288,205 (GRCm39) probably benign Het
Atp5mf A T 5: 145,124,992 (GRCm39) probably benign Het
Atp7b C T 8: 22,518,188 (GRCm39) E205K possibly damaging Het
Atp8b5 T A 4: 43,369,715 (GRCm39) probably null Het
Cd22 A G 7: 30,569,389 (GRCm39) Y402H possibly damaging Het
Cd248 A G 19: 5,119,990 (GRCm39) T613A probably benign Het
Cdcp2 C T 4: 106,963,904 (GRCm39) probably benign Het
Cenpc1 A T 5: 86,194,405 (GRCm39) D120E probably benign Het
Chd3 T A 11: 69,250,656 (GRCm39) H691L probably damaging Het
Colec12 C T 18: 9,858,921 (GRCm39) P568L unknown Het
Cped1 T A 6: 22,121,038 (GRCm39) Y373N probably benign Het
Cr2 A T 1: 194,848,539 (GRCm39) V328D probably damaging Het
Ctnnd2 A T 15: 30,922,059 (GRCm39) E895V probably damaging Het
D630045J12Rik A T 6: 38,126,706 (GRCm39) probably benign Het
Dcdc2a A T 13: 25,371,655 (GRCm39) probably benign Het
Dync1h1 C A 12: 110,585,108 (GRCm39) T837K probably benign Het
Eif2ak3 C A 6: 70,858,716 (GRCm39) probably benign Het
Epb41l5 A C 1: 119,477,632 (GRCm39) V705G possibly damaging Het
Fat2 T A 11: 55,142,944 (GRCm39) M4302L probably benign Het
Flnb T C 14: 7,901,951 (GRCm38) V938A probably damaging Het
Frmd4a T C 2: 4,608,903 (GRCm39) Y928H probably damaging Het
Fyn C T 10: 39,387,978 (GRCm39) T78M probably benign Het
Gdap2 A G 3: 100,109,311 (GRCm39) T443A probably damaging Het
Gde1 A T 7: 118,294,283 (GRCm39) F63L probably benign Het
Gjc3 A G 5: 137,956,202 (GRCm39) S28P probably benign Het
Gm10250 G A 15: 5,150,473 (GRCm39) probably null Het
Hp1bp3 C T 4: 137,964,520 (GRCm39) S348F probably damaging Het
Klhl23 T C 2: 69,664,310 (GRCm39) V553A probably damaging Het
Lman2l G T 1: 36,463,945 (GRCm39) S171* probably null Het
Lrp1b T C 2: 41,401,520 (GRCm39) D378G probably damaging Het
Map3k11 T C 19: 5,740,843 (GRCm39) L190P probably damaging Het
Mki67 T A 7: 135,298,188 (GRCm39) Q2282L probably damaging Het
Mthfd2 T A 6: 83,285,990 (GRCm39) I272F probably damaging Het
Myom1 A T 17: 71,352,750 (GRCm39) D358V probably damaging Het
Nebl T C 2: 17,395,737 (GRCm39) probably benign Het
Nebl T A 2: 17,397,834 (GRCm39) Q487H possibly damaging Het
Nlrp2 T A 7: 5,325,417 (GRCm39) N14Y possibly damaging Het
Or14a258 T C 7: 86,035,514 (GRCm39) Y118C probably damaging Het
Or1j11 T A 2: 36,312,299 (GRCm39) D296E probably benign Het
Or5ak22 T A 2: 85,230,305 (GRCm39) S191C probably damaging Het
Or8k40 T C 2: 86,584,231 (GRCm39) M284V probably benign Het
Pasd1 T C X: 70,983,161 (GRCm39) C378R possibly damaging Het
Paxip1 C T 5: 27,949,183 (GRCm39) probably benign Het
Pclo A G 5: 14,729,811 (GRCm39) probably benign Het
Pld2 T G 11: 70,445,174 (GRCm39) N591K probably benign Het
Plekha7 A G 7: 115,769,939 (GRCm39) M276T probably damaging Het
Prss39 T A 1: 34,541,281 (GRCm39) probably benign Het
Prtg A G 9: 72,716,998 (GRCm39) Y113C probably damaging Het
Rab38 T A 7: 88,099,749 (GRCm39) I88N probably damaging Het
Rbfox2 A G 15: 76,976,057 (GRCm39) probably benign Het
Samd5 A G 10: 9,550,683 (GRCm39) W9R probably damaging Het
Sec14l1 A T 11: 117,047,233 (GRCm39) K637I possibly damaging Het
Sh2b1 A T 7: 126,070,620 (GRCm39) D360E possibly damaging Het
Sh3bp4 A G 1: 89,073,036 (GRCm39) N628S possibly damaging Het
Sim1 A T 10: 50,784,057 (GRCm39) I104F probably damaging Het
Smcp T A 3: 92,491,827 (GRCm39) T7S unknown Het
Sp4 A G 12: 118,264,551 (GRCm39) probably benign Het
Tectb G T 19: 55,170,393 (GRCm39) K81N probably damaging Het
Thbs4 G T 13: 92,890,918 (GRCm39) H850N probably benign Het
Tiam1 T C 16: 89,694,642 (GRCm39) M272V probably benign Het
Trav13-3 T A 14: 53,967,233 (GRCm39) noncoding transcript Het
Ubap2l A T 3: 89,928,680 (GRCm39) S478T possibly damaging Het
Vmn2r85 A G 10: 130,255,054 (GRCm39) probably benign Het
Other mutations in Or2z8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03251:Or2z8 APN 8 72,811,920 (GRCm39) missense probably damaging 1.00
R0126:Or2z8 UTSW 8 72,812,244 (GRCm39) missense probably damaging 1.00
R0128:Or2z8 UTSW 8 72,812,244 (GRCm39) missense probably damaging 1.00
R0131:Or2z8 UTSW 8 72,812,244 (GRCm39) missense probably damaging 1.00
R0131:Or2z8 UTSW 8 72,812,244 (GRCm39) missense probably damaging 1.00
R0132:Or2z8 UTSW 8 72,812,244 (GRCm39) missense probably damaging 1.00
R0152:Or2z8 UTSW 8 72,812,244 (GRCm39) missense probably damaging 1.00
R0230:Or2z8 UTSW 8 72,812,244 (GRCm39) missense probably damaging 1.00
R0244:Or2z8 UTSW 8 72,812,244 (GRCm39) missense probably damaging 1.00
R0256:Or2z8 UTSW 8 72,812,244 (GRCm39) missense probably damaging 1.00
R0257:Or2z8 UTSW 8 72,812,244 (GRCm39) missense probably damaging 1.00
R0294:Or2z8 UTSW 8 72,812,244 (GRCm39) missense probably damaging 1.00
R0316:Or2z8 UTSW 8 72,812,244 (GRCm39) missense probably damaging 1.00
R0318:Or2z8 UTSW 8 72,812,244 (GRCm39) missense probably damaging 1.00
R0391:Or2z8 UTSW 8 72,812,244 (GRCm39) missense probably damaging 1.00
R0479:Or2z8 UTSW 8 72,812,244 (GRCm39) missense probably damaging 1.00
R0604:Or2z8 UTSW 8 72,812,244 (GRCm39) missense probably damaging 1.00
R0624:Or2z8 UTSW 8 72,812,006 (GRCm39) missense possibly damaging 0.94
R0631:Or2z8 UTSW 8 72,812,166 (GRCm39) missense probably damaging 0.99
R1785:Or2z8 UTSW 8 72,812,280 (GRCm39) missense probably damaging 1.00
R1786:Or2z8 UTSW 8 72,812,280 (GRCm39) missense probably damaging 1.00
R2040:Or2z8 UTSW 8 72,811,607 (GRCm39) missense possibly damaging 0.77
R4176:Or2z8 UTSW 8 72,812,028 (GRCm39) missense probably damaging 1.00
R4782:Or2z8 UTSW 8 72,811,938 (GRCm39) missense probably benign 0.00
R4799:Or2z8 UTSW 8 72,811,938 (GRCm39) missense probably benign 0.00
R6915:Or2z8 UTSW 8 72,811,574 (GRCm39) missense probably benign 0.19
R7512:Or2z8 UTSW 8 72,812,367 (GRCm39) missense probably damaging 1.00
R8255:Or2z8 UTSW 8 72,811,607 (GRCm39) missense possibly damaging 0.77
R9619:Or2z8 UTSW 8 72,811,605 (GRCm39) missense probably damaging 1.00
RF022:Or2z8 UTSW 8 72,812,468 (GRCm39) makesense probably null
Predicted Primers PCR Primer
(F):5'- CTGTCATGTGCAGACACATCAGCC -3'
(R):5'- GGATCGAAGGACATCATCGCTTCAC -3'

Sequencing Primer
(F):5'- ACATCAGCCTATGAGTTGGCG -3'
(R):5'- CAAGGACATTCGAACTTCTCTG -3'
Posted On 2013-06-12