Incidental Mutation 'R5495:Akt2'
ID501124
Institutional Source Beutler Lab
Gene Symbol Akt2
Ensembl Gene ENSMUSG00000004056
Gene Namethymoma viral proto-oncogene 2
SynonymsPKBbeta, PKB, 2410016A19Rik
MMRRC Submission 043056-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.907) question?
Stock #R5495 (G1)
Quality Score210
Status Not validated
Chromosome7
Chromosomal Location27591552-27640826 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 27636169 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000132141 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051356] [ENSMUST00000085917] [ENSMUST00000108342] [ENSMUST00000108343] [ENSMUST00000108344] [ENSMUST00000136962] [ENSMUST00000167435]
Predicted Effect probably null
Transcript: ENSMUST00000051356
SMART Domains Protein: ENSMUSP00000052103
Gene: ENSMUSG00000004056

DomainStartEndE-ValueType
PH 6 110 3.05e-18 SMART
S_TKc 152 409 1.23e-105 SMART
S_TK_X 410 477 1.16e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000085917
SMART Domains Protein: ENSMUSP00000083081
Gene: ENSMUSG00000004056

DomainStartEndE-ValueType
PH 6 110 3.05e-18 SMART
Pfam:Pkinase 152 279 4.4e-32 PFAM
Pfam:Pkinase_Tyr 152 279 7.7e-15 PFAM
Pfam:Pkinase_Tyr 276 351 7e-6 PFAM
Pfam:Pkinase 277 366 1.3e-16 PFAM
S_TK_X 367 434 1.16e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108342
SMART Domains Protein: ENSMUSP00000103979
Gene: ENSMUSG00000004056

DomainStartEndE-ValueType
PH 6 110 3.05e-18 SMART
Pfam:Pkinase 142 222 1.2e-13 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000108343
SMART Domains Protein: ENSMUSP00000103980
Gene: ENSMUSG00000004056

DomainStartEndE-ValueType
PH 6 110 3.05e-18 SMART
S_TKc 152 409 1.23e-105 SMART
S_TK_X 410 477 1.16e-14 SMART
Predicted Effect probably null
Transcript: ENSMUST00000108344
SMART Domains Protein: ENSMUSP00000103981
Gene: ENSMUSG00000004056

DomainStartEndE-ValueType
PH 6 110 3.05e-18 SMART
S_TKc 152 409 1.23e-105 SMART
S_TK_X 410 477 1.16e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000136962
SMART Domains Protein: ENSMUSP00000117682
Gene: ENSMUSG00000004056

DomainStartEndE-ValueType
PH 6 110 3.05e-18 SMART
Pfam:Pkinase 152 229 9.6e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136981
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143347
Predicted Effect probably null
Transcript: ENSMUST00000167435
SMART Domains Protein: ENSMUSP00000132141
Gene: ENSMUSG00000004056

DomainStartEndE-ValueType
PH 6 110 3.05e-18 SMART
S_TKc 152 409 1.23e-105 SMART
S_TK_X 410 477 1.16e-14 SMART
Coding Region Coverage
  • 1x: 98.4%
  • 3x: 97.3%
  • 10x: 95.3%
  • 20x: 91.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a putative oncogene encoding a protein belonging to a subfamily of serine/threonine kinases containing SH2-like (Src homology 2-like) domains. The gene was shown to be amplified and overexpressed in 2 of 8 ovarian carcinoma cell lines and 2 of 15 primary ovarian tumors. Overexpression contributes to the malignant phenotype of a subset of human ductal pancreatic cancers. The encoded protein is a general protein kinase capable of phophorylating several known proteins. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit insulin resistance and elevated plasma triglycerides. In males, the insulin resistance may progress to overt diabetes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130204L05Rik A T 3: 91,090,295 L38M possibly damaging Het
Arhgap29 T G 3: 122,014,929 M844R probably damaging Het
Atp1a1 T G 3: 101,591,425 D184A probably benign Het
Bcl11a T A 11: 24,165,042 V795E possibly damaging Het
Casp12 T A 9: 5,353,797 I277N possibly damaging Het
Ccdc59 A G 10: 105,845,378 K164E probably damaging Het
D630003M21Rik C T 2: 158,220,511 G30S possibly damaging Het
Dgkd A G 1: 87,926,872 D632G probably damaging Het
Efr3a A G 15: 65,815,409 K56E possibly damaging Het
Egflam T A 15: 7,251,241 R434S probably damaging Het
Fancl C G 11: 26,397,801 A51G probably damaging Het
Fkbp7 T C 2: 76,663,294 Y185C probably damaging Het
Galc A G 12: 98,231,414 probably null Het
Galnt15 A G 14: 32,029,817 S109G probably damaging Het
Gm13757 T C 2: 88,446,057 T294A probably benign Het
Gramd3 T C 18: 56,482,622 I163T probably damaging Het
Impa1 A G 3: 10,326,170 V80A probably benign Het
Itga10 T C 3: 96,647,371 M56T possibly damaging Het
Larp1b G T 3: 41,035,822 R135I probably damaging Het
Lgals12 C T 19: 7,604,130 A71T probably damaging Het
Lmbr1 A T 5: 29,346,853 L78* probably null Het
Lrat C A 3: 82,896,982 M229I probably benign Het
Mug2 A T 6: 122,079,650 M1185L probably damaging Het
Naprt T C 15: 75,893,847 probably null Het
Nfat5 A G 8: 107,368,447 I1107V probably benign Het
Nr4a2 T C 2: 57,112,375 Y22C probably damaging Het
Ogfod1 C A 8: 94,064,278 Q526K probably benign Het
Olfr139 G A 11: 74,044,785 T163I probably damaging Het
Olfr710 C A 7: 106,944,492 G170* probably null Het
Olfr957 T C 9: 39,511,145 T192A probably benign Het
Parp10 T G 15: 76,243,166 I24L probably benign Het
Pcdha11 A G 18: 37,011,026 T57A probably benign Het
Prdm8 A G 5: 98,185,306 E244G possibly damaging Het
Prl6a1 T C 13: 27,312,671 S3P possibly damaging Het
Rab11fip3 T A 17: 26,016,143 T18S probably damaging Het
Rfc4 T C 16: 23,122,254 probably benign Het
Rubcnl G T 14: 75,042,337 V387F possibly damaging Het
Serpinb12 T C 1: 106,956,421 L299P probably damaging Het
Sptbn5 G A 2: 120,046,484 probably benign Het
Taar4 A T 10: 23,961,283 I264F possibly damaging Het
Tdpoz4 A T 3: 93,797,499 T368S probably benign Het
Thsd7b T A 1: 129,595,833 H124Q probably damaging Het
Ugt1a6a A T 1: 88,139,024 Q184L probably benign Het
Vnn1 T A 10: 23,898,564 F168L probably damaging Het
Zan A G 5: 137,470,408 L267P probably damaging Het
Zswim8 A G 14: 20,722,286 S1621G probably damaging Het
Other mutations in Akt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01358:Akt2 APN 7 27636154 missense probably damaging 1.00
IGL01981:Akt2 APN 7 27638074 missense probably benign 0.04
IGL02340:Akt2 APN 7 27629399 missense probably damaging 1.00
IGL02794:Akt2 APN 7 27629381 missense probably benign 0.00
Pedunculated UTSW 7 27637170 missense probably benign
Sessile UTSW 7 27633241 missense probably damaging 1.00
Slothful UTSW 7 27616349 missense possibly damaging 0.95
R0013:Akt2 UTSW 7 27636058 missense probably damaging 1.00
R0129:Akt2 UTSW 7 27636970 missense probably damaging 1.00
R0355:Akt2 UTSW 7 27636909 splice site probably benign
R1515:Akt2 UTSW 7 27637158 missense probably damaging 1.00
R2207:Akt2 UTSW 7 27637200 splice site probably null
R2921:Akt2 UTSW 7 27628986 missense probably benign 0.01
R4953:Akt2 UTSW 7 27638172 unclassified probably null
R5577:Akt2 UTSW 7 27636306 missense probably damaging 1.00
R6494:Akt2 UTSW 7 27616349 missense possibly damaging 0.95
R6987:Akt2 UTSW 7 27633241 missense probably damaging 1.00
R7034:Akt2 UTSW 7 27637012 critical splice donor site probably null
R7036:Akt2 UTSW 7 27637012 critical splice donor site probably null
R7461:Akt2 UTSW 7 27637170 missense probably benign
R7613:Akt2 UTSW 7 27637170 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGTCTGTCCCTCATATATTGGC -3'
(R):5'- GAATGAGCTCAAAGAGGCGCTC -3'

Sequencing Primer
(F):5'- GTCCCTCATATATTGGCTTTTGTTG -3'
(R):5'- TCAAAGAGGCGCTCGTGGTC -3'
Posted On2017-12-01