Incidental Mutation 'R5495:Efr3a'
ID501126
Institutional Source Beutler Lab
Gene Symbol Efr3a
Ensembl Gene ENSMUSG00000015002
Gene NameEFR3 homolog A
SynonymsA130089M23Rik, D030063F01Rik, C920006C10Rik
MMRRC Submission 043056-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.462) question?
Stock #R5495 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location65787034-65873816 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 65815409 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 56 (K56E)
Ref Sequence ENSEMBL: ENSMUSP00000148418 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015146] [ENSMUST00000172756] [ENSMUST00000173858] [ENSMUST00000174856] [ENSMUST00000211878]
Predicted Effect probably benign
Transcript: ENSMUST00000015146
AA Change: K29E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000015146
Gene: ENSMUSG00000015002
AA Change: K29E

DomainStartEndE-ValueType
SCOP:d1gw5a_ 226 584 5e-4 SMART
low complexity region 709 720 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172756
AA Change: K29E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000134683
Gene: ENSMUSG00000015002
AA Change: K29E

DomainStartEndE-ValueType
PDB:4N5A|A 10 112 3e-6 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000173858
AA Change: K29E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000134385
Gene: ENSMUSG00000015002
AA Change: K29E

DomainStartEndE-ValueType
SCOP:d1gw5a_ 226 584 8e-4 SMART
low complexity region 709 720 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174591
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174601
Predicted Effect probably benign
Transcript: ENSMUST00000174856
Predicted Effect possibly damaging
Transcript: ENSMUST00000211878
AA Change: K56E

PolyPhen 2 Score 0.733 (Sensitivity: 0.86; Specificity: 0.92)
Coding Region Coverage
  • 1x: 98.4%
  • 3x: 97.3%
  • 10x: 95.3%
  • 20x: 91.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of a complex that plays a role in maintaining an active pool of phosphatidylinositol 4-kinase (PI4K) at the plasma membrane. This protein is thought to be a peripheral membrane protein that associates with the plasma membrane through palmitoylation. Studies indicate that this gene product plays a role in controlling G protein-coupled receptor (GPCR) activity by affecting receptor phosphorylation. Whole exome sequencing studies have implicated mutations in this gene with autism spectrum disorders. [provided by RefSeq, Apr 2016]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130204L05Rik A T 3: 91,090,295 L38M possibly damaging Het
Akt2 T C 7: 27,636,169 probably null Het
Arhgap29 T G 3: 122,014,929 M844R probably damaging Het
Atp1a1 T G 3: 101,591,425 D184A probably benign Het
Bcl11a T A 11: 24,165,042 V795E possibly damaging Het
Casp12 T A 9: 5,353,797 I277N possibly damaging Het
Ccdc59 A G 10: 105,845,378 K164E probably damaging Het
D630003M21Rik C T 2: 158,220,511 G30S possibly damaging Het
Dgkd A G 1: 87,926,872 D632G probably damaging Het
Egflam T A 15: 7,251,241 R434S probably damaging Het
Fancl C G 11: 26,397,801 A51G probably damaging Het
Fkbp7 T C 2: 76,663,294 Y185C probably damaging Het
Galc A G 12: 98,231,414 probably null Het
Galnt15 A G 14: 32,029,817 S109G probably damaging Het
Gm13757 T C 2: 88,446,057 T294A probably benign Het
Gramd3 T C 18: 56,482,622 I163T probably damaging Het
Impa1 A G 3: 10,326,170 V80A probably benign Het
Itga10 T C 3: 96,647,371 M56T possibly damaging Het
Larp1b G T 3: 41,035,822 R135I probably damaging Het
Lgals12 C T 19: 7,604,130 A71T probably damaging Het
Lmbr1 A T 5: 29,346,853 L78* probably null Het
Lrat C A 3: 82,896,982 M229I probably benign Het
Mug2 A T 6: 122,079,650 M1185L probably damaging Het
Naprt T C 15: 75,893,847 probably null Het
Nfat5 A G 8: 107,368,447 I1107V probably benign Het
Nr4a2 T C 2: 57,112,375 Y22C probably damaging Het
Ogfod1 C A 8: 94,064,278 Q526K probably benign Het
Olfr139 G A 11: 74,044,785 T163I probably damaging Het
Olfr710 C A 7: 106,944,492 G170* probably null Het
Olfr957 T C 9: 39,511,145 T192A probably benign Het
Parp10 T G 15: 76,243,166 I24L probably benign Het
Pcdha11 A G 18: 37,011,026 T57A probably benign Het
Prdm8 A G 5: 98,185,306 E244G possibly damaging Het
Prl6a1 T C 13: 27,312,671 S3P possibly damaging Het
Rab11fip3 T A 17: 26,016,143 T18S probably damaging Het
Rfc4 T C 16: 23,122,254 probably benign Het
Rubcnl G T 14: 75,042,337 V387F possibly damaging Het
Serpinb12 T C 1: 106,956,421 L299P probably damaging Het
Sptbn5 G A 2: 120,046,484 probably benign Het
Taar4 A T 10: 23,961,283 I264F possibly damaging Het
Tdpoz4 A T 3: 93,797,499 T368S probably benign Het
Thsd7b T A 1: 129,595,833 H124Q probably damaging Het
Ugt1a6a A T 1: 88,139,024 Q184L probably benign Het
Vnn1 T A 10: 23,898,564 F168L probably damaging Het
Zan A G 5: 137,470,408 L267P probably damaging Het
Zswim8 A G 14: 20,722,286 S1621G probably damaging Het
Other mutations in Efr3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00642:Efr3a APN 15 65855417 missense possibly damaging 0.66
IGL01070:Efr3a APN 15 65853078 missense probably benign
IGL01366:Efr3a APN 15 65851150 missense probably benign 0.37
IGL01754:Efr3a APN 15 65854720 missense probably damaging 0.96
IGL02121:Efr3a APN 15 65871150 splice site probably benign
R0096:Efr3a UTSW 15 65855441 missense probably damaging 1.00
R0096:Efr3a UTSW 15 65855441 missense probably damaging 1.00
R0139:Efr3a UTSW 15 65845981 missense possibly damaging 0.58
R0449:Efr3a UTSW 15 65842704 missense probably damaging 1.00
R0786:Efr3a UTSW 15 65853551 missense possibly damaging 0.47
R0827:Efr3a UTSW 15 65853551 missense possibly damaging 0.70
R0843:Efr3a UTSW 15 65837423 splice site probably benign
R1433:Efr3a UTSW 15 65869057 intron probably benign
R1572:Efr3a UTSW 15 65854792 critical splice donor site probably null
R2290:Efr3a UTSW 15 65849839 missense probably benign 0.00
R2764:Efr3a UTSW 15 65849770 missense possibly damaging 0.94
R4170:Efr3a UTSW 15 65845982 missense probably damaging 0.98
R4368:Efr3a UTSW 15 65866780 missense possibly damaging 0.82
R4683:Efr3a UTSW 15 65819801 missense probably damaging 1.00
R4797:Efr3a UTSW 15 65857588 missense probably damaging 1.00
R6262:Efr3a UTSW 15 65857474 missense possibly damaging 0.90
R6552:Efr3a UTSW 15 65857490 missense possibly damaging 0.52
R6825:Efr3a UTSW 15 65829830 missense probably benign 0.18
R6833:Efr3a UTSW 15 65842686 missense probably damaging 1.00
R6852:Efr3a UTSW 15 65829830 missense probably benign 0.18
R6853:Efr3a UTSW 15 65829830 missense probably benign 0.18
R6996:Efr3a UTSW 15 65848181 nonsense probably null
R7327:Efr3a UTSW 15 65819778 missense probably damaging 0.98
R7467:Efr3a UTSW 15 65857511 missense possibly damaging 0.65
R7549:Efr3a UTSW 15 65815413 critical splice donor site probably null
R7671:Efr3a UTSW 15 65837434 critical splice acceptor site probably null
R7810:Efr3a UTSW 15 65787173 start gained probably benign
R7830:Efr3a UTSW 15 65829830 missense probably benign 0.18
R7832:Efr3a UTSW 15 65829830 missense probably benign 0.18
R7900:Efr3a UTSW 15 65848135 splice site probably null
R7904:Efr3a UTSW 15 65824678 missense probably damaging 1.00
R7915:Efr3a UTSW 15 65829830 missense probably benign 0.18
R7983:Efr3a UTSW 15 65848135 splice site probably null
R7987:Efr3a UTSW 15 65824678 missense probably damaging 1.00
R8115:Efr3a UTSW 15 65866795 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCACTGTGTCGGAGTTTG -3'
(R):5'- AAGGACACCATGCAGCTATC -3'

Sequencing Primer
(F):5'- CTGACTCCTAAGGTAAATTGAGTAGG -3'
(R):5'- GGACACCATGCAGCTATCATTTCAG -3'
Posted On2017-12-01