Incidental Mutation 'R5495:Naprt'
ID501127
Institutional Source Beutler Lab
Gene Symbol Naprt
Ensembl Gene ENSMUSG00000022574
Gene Namenicotinate phosphoribosyltransferase
SynonymsNaprt1, 9130210N20Rik
MMRRC Submission 043056-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R5495 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location75890956-75894481 bp(-) (GRCm38)
Type of Mutationunclassified (358 bp from exon)
DNA Base Change (assembly) T to C at 75893847 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000116360 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023235] [ENSMUST00000023237] [ENSMUST00000089680] [ENSMUST00000089681] [ENSMUST00000109972] [ENSMUST00000109975] [ENSMUST00000116440] [ENSMUST00000123712] [ENSMUST00000137426] [ENSMUST00000141268] [ENSMUST00000144614] [ENSMUST00000151066] [ENSMUST00000154584] [ENSMUST00000229571]
Predicted Effect probably null
Transcript: ENSMUST00000023235
SMART Domains Protein: ENSMUSP00000023235
Gene: ENSMUSG00000055762

DomainStartEndE-ValueType
low complexity region 62 75 N/A INTRINSIC
coiled coil region 82 120 N/A INTRINSIC
EF-1_beta_acid 159 186 2.53e-4 SMART
Pfam:EF1_GNE 195 245 3.3e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000023237
AA Change: D76G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023237
Gene: ENSMUSG00000022574
AA Change: D76G

DomainStartEndE-ValueType
PDB:4MZY|A 16 522 2e-70 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000055220
Predicted Effect probably null
Transcript: ENSMUST00000089680
SMART Domains Protein: ENSMUSP00000087109
Gene: ENSMUSG00000055762

DomainStartEndE-ValueType
low complexity region 54 70 N/A INTRINSIC
coiled coil region 77 115 N/A INTRINSIC
EF-1_beta_acid 154 181 2.53e-4 SMART
EF1_GNE 190 276 4.87e-41 SMART
Predicted Effect probably null
Transcript: ENSMUST00000089681
SMART Domains Protein: ENSMUSP00000087110
Gene: ENSMUSG00000055762

DomainStartEndE-ValueType
low complexity region 32 52 N/A INTRINSIC
low complexity region 66 76 N/A INTRINSIC
internal_repeat_2 108 136 2.92e-5 PROSPERO
low complexity region 137 156 N/A INTRINSIC
internal_repeat_2 231 259 2.92e-5 PROSPERO
internal_repeat_1 244 263 2.02e-6 PROSPERO
internal_repeat_1 389 408 2.02e-6 PROSPERO
low complexity region 441 454 N/A INTRINSIC
coiled coil region 461 499 N/A INTRINSIC
EF-1_beta_acid 538 565 2.53e-4 SMART
EF1_GNE 574 660 4.87e-41 SMART
Predicted Effect probably null
Transcript: ENSMUST00000109972
SMART Domains Protein: ENSMUSP00000105599
Gene: ENSMUSG00000055762

DomainStartEndE-ValueType
low complexity region 35 51 N/A INTRINSIC
coiled coil region 58 96 N/A INTRINSIC
EF-1_beta_acid 135 162 2.53e-4 SMART
EF1_GNE 171 257 4.87e-41 SMART
Predicted Effect probably null
Transcript: ENSMUST00000109975
SMART Domains Protein: ENSMUSP00000105602
Gene: ENSMUSG00000055762

DomainStartEndE-ValueType
low complexity region 32 52 N/A INTRINSIC
low complexity region 66 76 N/A INTRINSIC
internal_repeat_2 108 136 2.92e-5 PROSPERO
low complexity region 137 156 N/A INTRINSIC
internal_repeat_2 231 259 2.92e-5 PROSPERO
internal_repeat_1 244 263 2.02e-6 PROSPERO
internal_repeat_1 389 408 2.02e-6 PROSPERO
low complexity region 441 454 N/A INTRINSIC
coiled coil region 461 499 N/A INTRINSIC
EF-1_beta_acid 538 565 2.53e-4 SMART
EF1_GNE 574 660 4.87e-41 SMART
Predicted Effect probably null
Transcript: ENSMUST00000116440
SMART Domains Protein: ENSMUSP00000112141
Gene: ENSMUSG00000055762

DomainStartEndE-ValueType
low complexity region 35 51 N/A INTRINSIC
coiled coil region 58 96 N/A INTRINSIC
EF-1_beta_acid 135 162 2.53e-4 SMART
EF1_GNE 171 257 4.87e-41 SMART
Predicted Effect probably null
Transcript: ENSMUST00000123712
SMART Domains Protein: ENSMUSP00000122155
Gene: ENSMUSG00000055762

DomainStartEndE-ValueType
low complexity region 35 51 N/A INTRINSIC
coiled coil region 58 96 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129800
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134222
Predicted Effect probably null
Transcript: ENSMUST00000137426
SMART Domains Protein: ENSMUSP00000114753
Gene: ENSMUSG00000055762

DomainStartEndE-ValueType
low complexity region 53 72 N/A INTRINSIC
internal_repeat_1 160 179 9.48e-6 PROSPERO
internal_repeat_1 305 324 9.48e-6 PROSPERO
low complexity region 330 346 N/A INTRINSIC
coiled coil region 353 391 N/A INTRINSIC
EF-1_beta_acid 430 457 2.53e-4 SMART
EF1_GNE 466 552 4.87e-41 SMART
Predicted Effect probably null
Transcript: ENSMUST00000141268
SMART Domains Protein: ENSMUSP00000115553
Gene: ENSMUSG00000055762

DomainStartEndE-ValueType
low complexity region 78 94 N/A INTRINSIC
coiled coil region 101 139 N/A INTRINSIC
EF-1_beta_acid 178 205 2.53e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000144614
SMART Domains Protein: ENSMUSP00000123005
Gene: ENSMUSG00000055762

DomainStartEndE-ValueType
low complexity region 62 75 N/A INTRINSIC
coiled coil region 82 120 N/A INTRINSIC
EF-1_beta_acid 159 186 2.53e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000151066
SMART Domains Protein: ENSMUSP00000118889
Gene: ENSMUSG00000055762

DomainStartEndE-ValueType
EF-1_beta_acid 68 95 2.53e-4 SMART
EF1_GNE 104 190 4.87e-41 SMART
Predicted Effect probably null
Transcript: ENSMUST00000154584
SMART Domains Protein: ENSMUSP00000116360
Gene: ENSMUSG00000055762

DomainStartEndE-ValueType
low complexity region 62 75 N/A INTRINSIC
coiled coil region 82 120 N/A INTRINSIC
EF-1_beta_acid 159 186 1.2e-8 SMART
EF1_GNE 195 280 4.9e-41 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000229571
AA Change: D76G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230259
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230739
Coding Region Coverage
  • 1x: 98.4%
  • 3x: 97.3%
  • 10x: 95.3%
  • 20x: 91.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nicotinic acid (NA; niacin) is converted by nicotinic acid phosphoribosyltransferase (NAPRT; EC 2.4.2.11) to NA mononucleotide (NaMN), which is then converted to NA adenine dinucleotide (NaAD), and finally to nicotinamide adenine dinucleotide (NAD), which serves as a coenzyme in cellular redox reactions and is an essential component of a variety of processes in cellular metabolism including response to stress (Hara et al., 2007).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130204L05Rik A T 3: 91,090,295 L38M possibly damaging Het
Akt2 T C 7: 27,636,169 probably null Het
Arhgap29 T G 3: 122,014,929 M844R probably damaging Het
Atp1a1 T G 3: 101,591,425 D184A probably benign Het
Bcl11a T A 11: 24,165,042 V795E possibly damaging Het
Casp12 T A 9: 5,353,797 I277N possibly damaging Het
Ccdc59 A G 10: 105,845,378 K164E probably damaging Het
D630003M21Rik C T 2: 158,220,511 G30S possibly damaging Het
Dgkd A G 1: 87,926,872 D632G probably damaging Het
Efr3a A G 15: 65,815,409 K56E possibly damaging Het
Egflam T A 15: 7,251,241 R434S probably damaging Het
Fancl C G 11: 26,397,801 A51G probably damaging Het
Fkbp7 T C 2: 76,663,294 Y185C probably damaging Het
Galc A G 12: 98,231,414 probably null Het
Galnt15 A G 14: 32,029,817 S109G probably damaging Het
Gm13757 T C 2: 88,446,057 T294A probably benign Het
Gramd3 T C 18: 56,482,622 I163T probably damaging Het
Impa1 A G 3: 10,326,170 V80A probably benign Het
Itga10 T C 3: 96,647,371 M56T possibly damaging Het
Larp1b G T 3: 41,035,822 R135I probably damaging Het
Lgals12 C T 19: 7,604,130 A71T probably damaging Het
Lmbr1 A T 5: 29,346,853 L78* probably null Het
Lrat C A 3: 82,896,982 M229I probably benign Het
Mug2 A T 6: 122,079,650 M1185L probably damaging Het
Nfat5 A G 8: 107,368,447 I1107V probably benign Het
Nr4a2 T C 2: 57,112,375 Y22C probably damaging Het
Ogfod1 C A 8: 94,064,278 Q526K probably benign Het
Olfr139 G A 11: 74,044,785 T163I probably damaging Het
Olfr710 C A 7: 106,944,492 G170* probably null Het
Olfr957 T C 9: 39,511,145 T192A probably benign Het
Parp10 T G 15: 76,243,166 I24L probably benign Het
Pcdha11 A G 18: 37,011,026 T57A probably benign Het
Prdm8 A G 5: 98,185,306 E244G possibly damaging Het
Prl6a1 T C 13: 27,312,671 S3P possibly damaging Het
Rab11fip3 T A 17: 26,016,143 T18S probably damaging Het
Rfc4 T C 16: 23,122,254 probably benign Het
Rubcnl G T 14: 75,042,337 V387F possibly damaging Het
Serpinb12 T C 1: 106,956,421 L299P probably damaging Het
Sptbn5 G A 2: 120,046,484 probably benign Het
Taar4 A T 10: 23,961,283 I264F possibly damaging Het
Tdpoz4 A T 3: 93,797,499 T368S probably benign Het
Thsd7b T A 1: 129,595,833 H124Q probably damaging Het
Ugt1a6a A T 1: 88,139,024 Q184L probably benign Het
Vnn1 T A 10: 23,898,564 F168L probably damaging Het
Zan A G 5: 137,470,408 L267P probably damaging Het
Zswim8 A G 14: 20,722,286 S1621G probably damaging Het
Other mutations in Naprt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Naprt APN 15 75893315 missense probably damaging 1.00
IGL00846:Naprt APN 15 75891788 missense probably benign 0.13
IGL01510:Naprt APN 15 75890988 utr 3 prime probably benign
IGL01834:Naprt APN 15 75893799 missense probably damaging 1.00
IGL02002:Naprt APN 15 75891372 missense probably damaging 0.98
IGL02948:Naprt APN 15 75892357 missense probably damaging 0.99
R0440:Naprt UTSW 15 75891069 splice site probably benign
R0523:Naprt UTSW 15 75892465 missense probably damaging 1.00
R0681:Naprt UTSW 15 75893632 missense probably damaging 1.00
R2114:Naprt UTSW 15 75891788 missense probably damaging 1.00
R4424:Naprt UTSW 15 75892756 splice site probably null
R5886:Naprt UTSW 15 75891475 unclassified probably null
R6166:Naprt UTSW 15 75891477 missense possibly damaging 0.94
R6282:Naprt UTSW 15 75891979 missense probably benign 0.00
R7167:Naprt UTSW 15 75892612 missense probably damaging 1.00
R7472:Naprt UTSW 15 75891758 intron probably null
X0018:Naprt UTSW 15 75892357 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GAGTGATCAGCTCCACAGTG -3'
(R):5'- CTGGCTTGCAGGACTGTATG -3'

Sequencing Primer
(F):5'- TCCACAGTGGAACCTCCTG -3'
(R):5'- GCAGGACTGTATGCGCTTTC -3'
Posted On2017-12-01