Incidental Mutation 'R5496:Kntc1'
ID501130
Institutional Source Beutler Lab
Gene Symbol Kntc1
Ensembl Gene ENSMUSG00000029414
Gene Namekinetochore associated 1
Synonyms
MMRRC Submission 043057-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.943) question?
Stock #R5496 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location123749716-123821593 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 123784182 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 948 (D948G)
Ref Sequence ENSEMBL: ENSMUSP00000031366 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031366]
Predicted Effect probably benign
Transcript: ENSMUST00000031366
AA Change: D948G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000031366
Gene: ENSMUSG00000029414
AA Change: D948G

DomainStartEndE-ValueType
low complexity region 345 357 N/A INTRINSIC
low complexity region 747 764 N/A INTRINSIC
low complexity region 1033 1044 N/A INTRINSIC
Pfam:Rod_C 1579 2128 3.2e-256 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197665
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198716
Predicted Effect probably benign
Transcript: ENSMUST00000198841
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.1%
  • 20x: 90.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is one of many involved in mechanisms to ensure proper chromosome segregation during cell division. Experimental evidence indicated that the encoded protein functioned in a similar manner to that of the Drosophila rough deal protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice have a kinked tail. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a G A 5: 8,674,818 V84I probably benign Het
Adam10 T G 9: 70,722,739 F151C probably damaging Het
Akap6 A G 12: 53,140,653 S1617G possibly damaging Het
Ano6 T A 15: 95,967,614 probably null Het
Atmin A G 8: 116,957,172 T524A probably benign Het
Bicra C T 7: 15,987,841 V584I probably benign Het
Carmil1 G A 13: 24,155,450 R54C probably damaging Het
Cbln1 A G 8: 87,471,696 I127T possibly damaging Het
Ccl26 A G 5: 135,563,363 V40A probably benign Het
Cdh7 T A 1: 110,048,917 I104N probably damaging Het
Cdt1 C T 8: 122,570,500 R311W probably damaging Het
Col12a1 A G 9: 79,602,185 probably benign Het
Csf2rb A G 15: 78,340,561 E173G probably damaging Het
Cyb561 A G 11: 105,937,719 Y94H probably damaging Het
Cyp3a16 T A 5: 145,467,531 K34M probably damaging Het
Diras2 C T 13: 52,507,750 V174M probably benign Het
Dnah7a T G 1: 53,457,768 M3110L probably benign Het
Dyrk2 T C 10: 118,860,051 E434G probably damaging Het
Ebag9 T G 15: 44,640,420 *214E probably null Het
Egln3 A T 12: 54,203,324 W80R probably damaging Het
Eps15l1 A G 8: 72,382,775 Y336H probably benign Het
Gak A G 5: 108,576,617 S1076P probably benign Het
Glra1 T C 11: 55,527,415 Y168C probably damaging Het
Glrx2 T A 1: 143,745,207 M108K probably damaging Het
Gm3604 A T 13: 62,371,579 S59T possibly damaging Het
Gm8212 A T 14: 44,201,157 probably benign Het
Gmcl1 G T 6: 86,697,525 A457D probably damaging Het
H2-M11 T C 17: 36,547,979 F137S possibly damaging Het
Ighv1-55 C G 12: 115,208,520 W3S probably damaging Het
Il22 T G 10: 118,205,097 V36G possibly damaging Het
Ints1 G A 5: 139,755,198 A1904V probably benign Het
Iqgap2 A G 13: 95,630,053 Y1481H probably damaging Het
Kcnn3 C T 3: 89,609,490 A402V possibly damaging Het
Kif18b A T 11: 102,913,742 I362N possibly damaging Het
Kif5c C G 2: 49,730,190 A223G possibly damaging Het
Krba1 A G 6: 48,406,356 T229A possibly damaging Het
Leprot T A 4: 101,657,896 I113N probably damaging Het
Lrp1b T C 2: 40,927,973 D2415G probably benign Het
Maats1 A G 16: 38,321,493 I359T probably damaging Het
Mnd1 T A 3: 84,088,174 D171V probably damaging Het
Mthfsd A T 8: 121,098,814 Y339* probably null Het
Nfatc2 G A 2: 168,536,278 T268M probably damaging Het
Olfr1097 G T 2: 86,890,314 P287Q probably damaging Het
Olfr1097 G C 2: 86,890,315 P287A probably damaging Het
Olfr116 T C 17: 37,624,578 D19G probably benign Het
Olfr653 G C 7: 104,580,494 A283P probably damaging Het
Pan3 G A 5: 147,527,128 probably null Het
Pde6a A T 18: 61,253,665 probably null Het
Prss39 T C 1: 34,500,261 I194T possibly damaging Het
Rfx8 T C 1: 39,670,347 S507G probably benign Het
Rif1 T C 2: 52,098,916 S774P probably damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Smurf1 C A 5: 144,882,593 E601* probably null Het
Stau2 T C 1: 16,390,021 S231G probably damaging Het
Timp2 T G 11: 118,303,881 M161L probably benign Het
Tlr5 T C 1: 182,973,632 L167P probably damaging Het
Trhr G A 15: 44,197,536 A151T probably benign Het
Unc13d A G 11: 116,066,708 V807A probably damaging Het
Usp2 T C 9: 44,085,208 V7A possibly damaging Het
Uspl1 A G 5: 149,209,779 T447A probably damaging Het
Zan A G 5: 137,436,345 I2232T unknown Het
Zfp12 C A 5: 143,244,795 C292* probably null Het
Zfp850 A C 7: 28,007,346 M43R probably damaging Het
Zic5 G A 14: 122,459,343 T620M unknown Het
Other mutations in Kntc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Kntc1 APN 5 123790159 missense probably benign 0.05
IGL00514:Kntc1 APN 5 123791527 missense probably benign 0.00
IGL01103:Kntc1 APN 5 123764220 missense probably damaging 0.96
IGL01106:Kntc1 APN 5 123762603 missense probably benign 0.01
IGL01357:Kntc1 APN 5 123757814 missense probably damaging 1.00
IGL01367:Kntc1 APN 5 123758483 missense probably damaging 1.00
IGL01538:Kntc1 APN 5 123781658 missense probably damaging 1.00
IGL01546:Kntc1 APN 5 123765005 missense probably benign 0.02
IGL01595:Kntc1 APN 5 123803695 missense probably benign 0.30
IGL01725:Kntc1 APN 5 123764190 missense probably benign
IGL01916:Kntc1 APN 5 123801913 missense probably damaging 1.00
IGL01936:Kntc1 APN 5 123811376 missense probably damaging 1.00
IGL01942:Kntc1 APN 5 123778267 missense probably damaging 1.00
IGL01973:Kntc1 APN 5 123765958 missense probably damaging 1.00
IGL01982:Kntc1 APN 5 123809096 missense probably benign 0.12
IGL02145:Kntc1 APN 5 123762598 missense possibly damaging 0.80
IGL02510:Kntc1 APN 5 123819062 missense probably benign 0.03
IGL02611:Kntc1 APN 5 123812065 missense probably damaging 1.00
IGL02669:Kntc1 APN 5 123755664 splice site probably benign
IGL02737:Kntc1 APN 5 123819120 missense probably benign 0.17
IGL02793:Kntc1 APN 5 123778277 unclassified probably null
IGL02809:Kntc1 APN 5 123776582 missense probably damaging 1.00
IGL02860:Kntc1 APN 5 123769873 missense possibly damaging 0.49
IGL02875:Kntc1 APN 5 123778277 unclassified probably null
IGL02931:Kntc1 APN 5 123799811 missense probably damaging 1.00
IGL03169:Kntc1 APN 5 123775821 missense possibly damaging 0.80
IGL03267:Kntc1 APN 5 123758480 missense probably damaging 1.00
R0006:Kntc1 UTSW 5 123789138 missense probably benign 0.19
R0006:Kntc1 UTSW 5 123789138 missense probably benign 0.19
R0017:Kntc1 UTSW 5 123780981 missense probably damaging 1.00
R0125:Kntc1 UTSW 5 123765057 splice site probably benign
R0324:Kntc1 UTSW 5 123778112 missense probably damaging 1.00
R0580:Kntc1 UTSW 5 123803669 missense probably benign 0.00
R0608:Kntc1 UTSW 5 123786074 missense probably damaging 0.98
R0725:Kntc1 UTSW 5 123769704 missense possibly damaging 0.92
R0733:Kntc1 UTSW 5 123790916 missense probably null
R0781:Kntc1 UTSW 5 123799902 splice site probably benign
R0787:Kntc1 UTSW 5 123796104 missense probably benign
R1250:Kntc1 UTSW 5 123784199 missense possibly damaging 0.71
R1253:Kntc1 UTSW 5 123810862 frame shift probably null
R1467:Kntc1 UTSW 5 123786984 missense probably benign 0.04
R1467:Kntc1 UTSW 5 123786984 missense probably benign 0.04
R1481:Kntc1 UTSW 5 123778275 missense probably benign 0.00
R1572:Kntc1 UTSW 5 123772113 missense probably damaging 0.99
R1624:Kntc1 UTSW 5 123758477 missense possibly damaging 0.48
R1749:Kntc1 UTSW 5 123789099 missense probably benign 0.00
R1993:Kntc1 UTSW 5 123759099 critical splice donor site probably null
R1993:Kntc1 UTSW 5 123810811 critical splice acceptor site probably null
R2071:Kntc1 UTSW 5 123794277 splice site probably null
R2237:Kntc1 UTSW 5 123803670 missense possibly damaging 0.50
R2239:Kntc1 UTSW 5 123803670 missense possibly damaging 0.50
R2366:Kntc1 UTSW 5 123781192 missense probably damaging 1.00
R2367:Kntc1 UTSW 5 123781192 missense probably damaging 1.00
R2382:Kntc1 UTSW 5 123760348 missense probably damaging 0.99
R2389:Kntc1 UTSW 5 123781192 missense probably damaging 1.00
R2413:Kntc1 UTSW 5 123764149 missense probably benign 0.01
R2442:Kntc1 UTSW 5 123810859 missense probably damaging 1.00
R2504:Kntc1 UTSW 5 123778347 nonsense probably null
R2943:Kntc1 UTSW 5 123797784 missense possibly damaging 0.68
R3116:Kntc1 UTSW 5 123802058 missense probably damaging 1.00
R4107:Kntc1 UTSW 5 123762598 missense probably damaging 0.99
R4176:Kntc1 UTSW 5 123776617 missense possibly damaging 0.76
R4275:Kntc1 UTSW 5 123767779 missense probably damaging 1.00
R4440:Kntc1 UTSW 5 123794153 missense probably damaging 1.00
R4575:Kntc1 UTSW 5 123765955 missense probably damaging 1.00
R4576:Kntc1 UTSW 5 123765955 missense probably damaging 1.00
R4578:Kntc1 UTSW 5 123765955 missense probably damaging 1.00
R4612:Kntc1 UTSW 5 123812643 missense probably damaging 1.00
R4704:Kntc1 UTSW 5 123811433 missense probably damaging 0.96
R4720:Kntc1 UTSW 5 123765023 missense possibly damaging 0.65
R4784:Kntc1 UTSW 5 123816762 missense possibly damaging 0.89
R4785:Kntc1 UTSW 5 123816762 missense possibly damaging 0.89
R4824:Kntc1 UTSW 5 123790133 nonsense probably null
R4847:Kntc1 UTSW 5 123802274 missense probably benign 0.18
R4849:Kntc1 UTSW 5 123759065 missense probably benign 0.02
R4904:Kntc1 UTSW 5 123778333 missense possibly damaging 0.47
R4922:Kntc1 UTSW 5 123802246 missense probably damaging 0.99
R5080:Kntc1 UTSW 5 123762586 missense possibly damaging 0.68
R5114:Kntc1 UTSW 5 123781055 critical splice donor site probably null
R5171:Kntc1 UTSW 5 123799844 missense probably benign 0.01
R5220:Kntc1 UTSW 5 123812097 missense probably damaging 1.00
R5226:Kntc1 UTSW 5 123794172 missense probably benign 0.09
R5278:Kntc1 UTSW 5 123781014 missense probably damaging 1.00
R5329:Kntc1 UTSW 5 123764191 missense probably benign 0.02
R5503:Kntc1 UTSW 5 123819876 missense possibly damaging 0.81
R5633:Kntc1 UTSW 5 123819057 missense probably damaging 0.99
R5638:Kntc1 UTSW 5 123818475 missense possibly damaging 0.65
R5697:Kntc1 UTSW 5 123765007 missense probably benign 0.00
R5757:Kntc1 UTSW 5 123807309 critical splice donor site probably null
R5773:Kntc1 UTSW 5 123794157 missense probably damaging 1.00
R5940:Kntc1 UTSW 5 123786195 missense probably benign 0.05
R6019:Kntc1 UTSW 5 123762516 missense probably benign 0.03
R6230:Kntc1 UTSW 5 123789009 splice site probably null
R6437:Kntc1 UTSW 5 123769691 missense probably damaging 0.98
R6888:Kntc1 UTSW 5 123811310 missense probably damaging 1.00
R6907:Kntc1 UTSW 5 123801825 missense probably damaging 1.00
R7123:Kntc1 UTSW 5 123781726 missense probably damaging 1.00
R7262:Kntc1 UTSW 5 123786973 missense probably benign 0.18
R7381:Kntc1 UTSW 5 123810908 missense probably benign 0.12
R7485:Kntc1 UTSW 5 123786956 missense possibly damaging 0.79
R7512:Kntc1 UTSW 5 123790938 missense probably damaging 1.00
R7581:Kntc1 UTSW 5 123816755 missense probably benign 0.05
R7687:Kntc1 UTSW 5 123759089 missense probably benign 0.01
R7798:Kntc1 UTSW 5 123786294 missense probably benign
R7798:Kntc1 UTSW 5 123819117 missense possibly damaging 0.94
R7871:Kntc1 UTSW 5 123784227 missense probably damaging 1.00
R7876:Kntc1 UTSW 5 123775787 missense probably damaging 1.00
R7954:Kntc1 UTSW 5 123784227 missense probably damaging 1.00
R7959:Kntc1 UTSW 5 123775787 missense probably damaging 1.00
R7997:Kntc1 UTSW 5 123778054 missense probably damaging 0.96
X0027:Kntc1 UTSW 5 123810929 missense probably benign 0.00
X0065:Kntc1 UTSW 5 123778037 nonsense probably null
X0067:Kntc1 UTSW 5 123778074 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CCGGACTGGAGCTACACATAAC -3'
(R):5'- GCCAGCTTCATGAAACGTGTAG -3'

Sequencing Primer
(F):5'- TGGAGCTACACATAACCCTCAG -3'
(R):5'- TCACATGCTGTAGTCTAAGATGAC -3'
Posted On2017-12-01