Incidental Mutation 'R5535:Hoxa13'
ID501136
Institutional Source Beutler Lab
Gene Symbol Hoxa13
Ensembl Gene ENSMUSG00000038203
Gene Namehomeobox A13
SynonymsHox-1.10
MMRRC Submission 043093-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5535 (G1)
Quality Score105
Status Not validated
Chromosome6
Chromosomal Location52257694-52260880 bp(-) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) GG to GGCG at 52260540 bp
ZygosityHomozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000039170 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047993] [ENSMUST00000114416] [ENSMUST00000147595]
Predicted Effect probably null
Transcript: ENSMUST00000047993
SMART Domains Protein: ENSMUSP00000039170
Gene: ENSMUSG00000038203

DomainStartEndE-ValueType
low complexity region 37 81 N/A INTRINSIC
Pfam:HoxA13_N 136 219 6.2e-25 PFAM
HOX 317 379 1.16e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114416
SMART Domains Protein: ENSMUSP00000110059
Gene: ENSMUSG00000038203

DomainStartEndE-ValueType
Pfam:HoxA13_N 1 55 1e-19 PFAM
HOX 153 215 1.16e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141300
Predicted Effect probably benign
Transcript: ENSMUST00000147595
SMART Domains Protein: ENSMUSP00000125221
Gene: ENSMUSG00000038203

DomainStartEndE-ValueType
Pfam:HoxA13_N 1 39 8.3e-11 PFAM
HOX 137 199 1.16e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152875
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172961
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173368
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174763
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184418
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185112
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185179
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192253
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In vertebrates, the genes encoding the class of transcription factors called homeobox genes are found in clusters named A, B, C, and D on four separate chromosomes. Expression of these proteins is spatially and temporally regulated during embryonic development. This gene is part of the A cluster on chromosome 7 and encodes a DNA-binding transcription factor which may regulate gene expression, morphogenesis, and differentiation. Expansion of a polyalanine tract in the encoded protein can cause hand-foot-uterus syndrome, also known as hand-foot-genital syndrome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit agenesis of both the urinary bladder and the caudal portion of the Mullerian ducts, premature stenosis of the umbilical arteries, loss of the most anterior digit of all feet, and death around mid-gestation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaa1b C T 9: 119,148,406 G403S probably damaging Het
Agbl2 G A 2: 90,810,006 V699I probably benign Het
Amer2 AAGGAGGAGGAGGAG AAGGAGGAGGAG 14: 60,378,853 probably benign Het
Bace2 A T 16: 97,413,425 Q271L probably damaging Het
Btn2a2 T C 13: 23,478,275 K493E probably benign Het
Ces3a T A 8: 105,051,564 D222E probably benign Het
Ckap2l A G 2: 129,285,842 C139R probably benign Het
Clip4 A G 17: 71,831,262 H485R probably benign Het
Cntfr T A 4: 41,663,216 D197V probably benign Het
Efcab5 A G 11: 77,151,921 L2P probably damaging Het
Elmo2 A G 2: 165,310,212 V163A possibly damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Flrt2 A G 12: 95,780,426 T513A probably benign Het
Gm10801 GT GTTTTT 2: 98,662,499 probably null Het
Hectd1 A T 12: 51,802,326 F332I probably damaging Het
Helz A G 11: 107,646,120 D947G probably damaging Het
Hivep2 T A 10: 14,131,022 D1121E probably benign Het
Hoxd13 A T 2: 74,668,797 Y163F probably damaging Het
Immt C A 6: 71,852,784 P158Q probably null Het
Kcnh5 A G 12: 75,130,907 S142P possibly damaging Het
Lnpep T G 17: 17,538,694 H796P probably benign Het
Mfhas1 C A 8: 35,590,269 R633S possibly damaging Het
Mmp25 A G 17: 23,644,760 L32P probably benign Het
Myo15b A G 11: 115,881,301 D299G probably damaging Het
Myo18b T C 5: 112,790,042 E1739G probably damaging Het
Olfr907 T A 9: 38,498,998 S110T probably benign Het
Parp9 A G 16: 35,956,825 K147E probably damaging Het
Pcdha3 G T 18: 36,947,936 R577L probably benign Het
Plod2 T A 9: 92,606,569 I637N probably damaging Het
Polk T G 13: 96,495,497 S243R probably damaging Het
Prag1 T C 8: 36,104,014 S584P probably benign Het
Prex1 A T 2: 166,580,273 V43E possibly damaging Het
Rdh10 T C 1: 16,131,184 Y294H probably damaging Het
Rnf126 T A 10: 79,762,699 I28F probably damaging Het
Sdk2 T A 11: 113,943,158 H66L possibly damaging Het
Tet1 G T 10: 62,832,907 P1431Q probably damaging Het
Tmco2 T A 4: 121,105,993 Q103L possibly damaging Het
Ucp3 A T 7: 100,480,666 R172W probably benign Het
Unc79 A T 12: 103,169,703 I2270F possibly damaging Het
Other mutations in Hoxa13
AlleleSourceChrCoordTypePredicted EffectPPH Score
H8786:Hoxa13 UTSW 6 52260636 frame shift probably null
PIT4131001:Hoxa13 UTSW 6 52260647 utr 5 prime probably benign
PIT4131001:Hoxa13 UTSW 6 52260648 utr 5 prime probably benign
PIT4142001:Hoxa13 UTSW 6 52260647 utr 5 prime probably benign
PIT4142001:Hoxa13 UTSW 6 52260648 utr 5 prime probably benign
R0458:Hoxa13 UTSW 6 52260635 frame shift probably null
R0496:Hoxa13 UTSW 6 52260635 frame shift probably null
R0502:Hoxa13 UTSW 6 52260635 frame shift probably null
R0512:Hoxa13 UTSW 6 52260635 frame shift probably null
R0784:Hoxa13 UTSW 6 52259937 missense probably damaging 0.98
R1062:Hoxa13 UTSW 6 52260635 frame shift probably null
R1157:Hoxa13 UTSW 6 52260635 frame shift probably null
R1192:Hoxa13 UTSW 6 52260635 frame shift probably null
R1310:Hoxa13 UTSW 6 52260635 frame shift probably null
R1341:Hoxa13 UTSW 6 52260635 frame shift probably null
R1343:Hoxa13 UTSW 6 52260635 frame shift probably null
R1398:Hoxa13 UTSW 6 52260647 utr 5 prime probably benign
R1398:Hoxa13 UTSW 6 52260648 utr 5 prime probably benign
R1400:Hoxa13 UTSW 6 52260647 utr 5 prime probably benign
R1400:Hoxa13 UTSW 6 52260648 utr 5 prime probably benign
R1450:Hoxa13 UTSW 6 52260647 utr 5 prime probably benign
R1450:Hoxa13 UTSW 6 52260648 utr 5 prime probably benign
R1632:Hoxa13 UTSW 6 52259937 missense probably damaging 0.98
R2382:Hoxa13 UTSW 6 52259145 missense probably damaging 0.98
R3149:Hoxa13 UTSW 6 52260304 intron probably benign
R4012:Hoxa13 UTSW 6 52259127 missense possibly damaging 0.47
R4426:Hoxa13 UTSW 6 52260729 utr 5 prime probably benign
R6175:Hoxa13 UTSW 6 52259928 missense probably damaging 0.98
R7365:Hoxa13 UTSW 6 52259882 missense probably damaging 1.00
R7770:Hoxa13 UTSW 6 52260267 critical splice acceptor site probably benign
R7926:Hoxa13 UTSW 6 52260636 frame shift probably null
R7931:Hoxa13 UTSW 6 52260637 frame shift probably null
R8960:Hoxa13 UTSW 6 52259996 missense probably benign 0.03
X0018:Hoxa13 UTSW 6 52260119 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- ATGTACTTGTCGGCGAAGG -3'
(R):5'- ATGTTTCTCTACGACAACGGC -3'

Sequencing Primer
(F):5'- TAGTAGCCGCTGCCGAAGTAG -3'
(R):5'- TACGACAACGGCGGCGG -3'
Posted On2017-12-01