Mutagenetix > Incidental Mutations

Incidental Mutation 'R5536:Galnt2'

501138

Institutional Source

Beutler Lab

Gene Symbol

Galnt2

Ensembl Gene

ENSMUSG00000089704

Gene Name

polypeptide N-acetylgalactosaminyltransferase 2

Synonyms

ppGaNTase-T2

MMRRC Submission

043094-MU

Accession Numbers

Ncbi RefSeq: NM_139272.2; MGI:894694

Is this an essential gene?

Probably non essential (E-score: 0.120) question?

Stock #

R5536 (G1)

Quality Score

195

Status

Not validated

Chromosome

Chromosomal Location

124231391-124345724 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 124323673 bp

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Arginine at position 91 (C91R)

Ref Sequence

ENSEMBL: ENSMUSP00000118564 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034458] [ENSMUST00000127664]

Predicted Effect

probably damaging
Transcript: ENSMUST00000034458
AA Change: C125R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000034458
Gene: ENSMUSG00000089704
AA Change: C125R

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
low complexity region	25	39	N/A	INTRINSIC
Pfam:Glycos_transf_2	138	321	8.3e-31	PFAM
Pfam:Glyco_transf_7C	295	365	5.4e-8	PFAM
RICIN	440	565	9.28e-27	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000127664
AA Change: C91R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329
AA Change: C91R

Domain	Start	End	E-Value	Type
Pfam:Glycos_transf_2	104	287	7.4e-31	PFAM
Pfam:Glyco_transf_7C	261	331	4.9e-8	PFAM
RICIN	406	531	9.28e-27	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142547

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142578

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147911

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159796

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.3%
20x: 95.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the glycosyltransferase 2 protein family. Members of this family initiate mucin-type O-glycoslation of peptides in the Golgi apparatus. The encoded protein may be involved in O-linked glycosylation of the immunoglobulin A1 hinge region. This gene may influence triglyceride levels, and may be involved Type 2 diabetes, as well as several types of cancer. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]

Allele List at MGI

None

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	G	T	3: 138,066,388	G446V	possibly damaging	Het
Aadac	T	G	3: 60,039,563	N227K	probably benign	Het
Acap1	C	T	11: 69,889,307	G74R	probably benign	Het
Adrm1	A	G	2: 180,172,188		probably benign	Het
Appl1	G	C	14: 26,923,780	S691*	probably null	Het
Atp2a2	T	C	5: 122,457,182	D1035G	probably benign	Het
AW551984	A	G	9: 39,592,873	I599T	probably benign	Het
Col23a1	C	A	11: 51,567,949	D304E	probably damaging	Het
Csmd1	T	C	8: 16,288,660	R478G	probably damaging	Het
Dnah7a	T	C	1: 53,425,253	N3660D	probably benign	Het
Drosha	T	A	15: 12,929,711	Y1331N	possibly damaging	Het
E2f6	T	G	12: 16,824,684	S256A	probably benign	Het
Evc	A	G	5: 37,326,583		probably benign	Het
Fsip2	A	T	2: 82,987,059	I4379F	probably benign	Het
Gm3095	G	T	14: 3,964,502	M73I	probably benign	Het
Gpr179	T	A	11: 97,343,815	Q480L	probably damaging	Het
Gucy2g	T	A	19: 55,237,927	I186F	probably benign	Het
Hmcn1	T	A	1: 150,755,291	I919F	probably benign	Het
Kdm3a	A	C	6: 71,611,936	V363G	probably benign	Het
Kmt2d	G	A	15: 98,852,109		probably benign	Het
Lama5	C	T	2: 180,189,349	R1839H	probably damaging	Het
Lpo	T	C	11: 87,816,563	D208G	probably damaging	Het
Lpp	A	G	16: 24,845,206	D411G	possibly damaging	Het
Marco	T	C	1: 120,504,735	S8G	possibly damaging	Het
Mthfr	T	C	4: 148,044,483	F171S	probably damaging	Het
Nlrx1	A	T	9: 44,263,886	S198T	probably damaging	Het
Nol10	C	A	12: 17,416,137	S511*	probably null	Het
Nup153	T	C	13: 46,683,009	T1375A	probably benign	Het
Obscn	A	G	11: 59,107,871	S1367P	probably damaging	Het
Olfr1269	A	G	2: 90,118,839	V253A	probably benign	Het
Pcdha7	G	A	18: 36,975,250	V443M	probably damaging	Het
Plekha1	G	T	7: 130,909,601	R305I	probably damaging	Het
Psmb2	T	A	4: 126,684,209	I60N	probably damaging	Het
Rad17	C	A	13: 100,631,104	G330C	probably damaging	Het
Slc5a6	A	G	5: 31,043,102	S80P	probably damaging	Het
Srgap2	T	A	1: 131,300,390		probably null	Het
Taf8	C	A	17: 47,494,482	R164L	possibly damaging	Het
Tmem87a	C	A	2: 120,397,430	D79Y	probably damaging	Het
Tmtc4	G	A	14: 122,932,879	R574W	probably benign	Het
Tprn	G	A	2: 25,263,357	A224T	probably benign	Het
Usf3	A	G	16: 44,217,370	T738A	probably benign	Het
Vmn2r54	A	C	7: 12,632,416	V197G	probably benign	Het
Zbtb40	G	T	4: 136,987,331	P1049Q	probably damaging	Het
Zfp551	A	T	7: 12,415,561	S640R	possibly damaging	Het
Zfp932	T	A	5: 110,009,847	C470*	probably null	Het
Zkscan8	T	C	13: 21,526,668	I91V	probably damaging	Het
Zmat4	T	C	8: 23,748,492	V30A	probably damaging	Het

Other mutations in Galnt2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02187:Galnt2	APN	8	124305506	splice site	probably benign
IGL02638:Galnt2	APN	8	124231579	missense	probably damaging	0.98
chivalry	UTSW	8	124334286	nonsense	probably null
gallantry	UTSW	8	124340822	missense	probably damaging	1.00
valor	UTSW	8	124329788	missense	probably damaging	1.00
P0018:Galnt2	UTSW	8	124336611	missense	probably damaging	1.00
R0133:Galnt2	UTSW	8	124338538	missense	probably benign	0.19
R0453:Galnt2	UTSW	8	124338584	splice site	probably benign
R0709:Galnt2	UTSW	8	124343346	missense	probably benign	0.01
R1015:Galnt2	UTSW	8	124336617	missense	probably benign
R4388:Galnt2	UTSW	8	124295453	critical splice donor site	probably null
R4400:Galnt2	UTSW	8	124324303	missense	probably damaging	1.00
R4447:Galnt2	UTSW	8	124295377	missense	probably benign	0.04
R4448:Galnt2	UTSW	8	124295377	missense	probably benign	0.04
R4449:Galnt2	UTSW	8	124295377	missense	probably benign	0.04
R4450:Galnt2	UTSW	8	124295377	missense	probably benign	0.04
R4927:Galnt2	UTSW	8	124305623	missense	probably damaging	1.00
R6218:Galnt2	UTSW	8	124343315	missense	probably benign	0.01
R6732:Galnt2	UTSW	8	124340822	missense	probably damaging	1.00
R6795:Galnt2	UTSW	8	124343436	missense	probably damaging	1.00
R6823:Galnt2	UTSW	8	124324011	missense	probably benign
R7173:Galnt2	UTSW	8	124305553	missense	probably benign	0.00
R7479:Galnt2	UTSW	8	124334338	missense	probably damaging	1.00
R7818:Galnt2	UTSW	8	124329788	missense	probably damaging	1.00
R7821:Galnt2	UTSW	8	124343395	missense	possibly damaging	0.51
R7831:Galnt2	UTSW	8	124332078	missense	probably benign	0.04
R8348:Galnt2	UTSW	8	124334286	nonsense	probably null
R8770:Galnt2	UTSW	8	124334286	nonsense	probably null
R8826:Galnt2	UTSW	8	124305608	missense	probably damaging	1.00
X0024:Galnt2	UTSW	8	124343345	missense	probably benign	0.28
Z1177:Galnt2	UTSW	8	124343318	missense	probably benign	0.24

Predicted Primers

PCR Primer
(F):5'- AGAACGCCCTTGTCTGTAAGC -3'
(R):5'- GCTGATGTCCTGTCTGTAGC -3'

Sequencing Primer
(F):5'- TAAGCAGAACCTGGCTGTAGCTC -3'
(R):5'- GATGTCCTGTCTGTAGCCCCAG -3'

Posted On

2017-12-01