Incidental Mutation 'R5556:Accs'
List |< first << previous [record 4 of 56] next >> last >|
ID501150
Institutional Source Beutler Lab
Gene Symbol Accs
Ensembl Gene ENSMUSG00000040272
Gene Name1-aminocyclopropane-1-carboxylate synthase (non-functional)
Synonyms2610203E10Rik
MMRRC Submission 043113-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R5556 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location93833467-93849943 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 93836083 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 420 (Y420H)
Ref Sequence ENSEMBL: ENSMUSP00000106877 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041593] [ENSMUST00000068513] [ENSMUST00000111246]
Predicted Effect probably damaging
Transcript: ENSMUST00000041593
AA Change: Y397H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000036268
Gene: ENSMUSG00000040272
AA Change: Y397H

DomainStartEndE-ValueType
low complexity region 35 43 N/A INTRINSIC
Pfam:Aminotran_1_2 74 448 1.9e-59 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000068513
AA Change: Y397H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000065389
Gene: ENSMUSG00000040272
AA Change: Y397H

DomainStartEndE-ValueType
low complexity region 35 43 N/A INTRINSIC
Pfam:Aminotran_1_2 74 448 1.9e-59 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111246
AA Change: Y420H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106877
Gene: ENSMUSG00000040272
AA Change: Y420H

DomainStartEndE-ValueType
low complexity region 58 66 N/A INTRINSIC
Pfam:Aminotran_1_2 97 471 2.1e-58 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128719
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146045
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146436
Predicted Effect probably benign
Transcript: ENSMUST00000150666
SMART Domains Protein: ENSMUSP00000119096
Gene: ENSMUSG00000040272

DomainStartEndE-ValueType
SCOP:d1b8ga_ 2 72 7e-9 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik C A 1: 105,693,167 Q456K probably benign Het
4933427D14Rik T A 11: 72,175,200 probably null Het
Abca13 A T 11: 9,258,546 I240F possibly damaging Het
Aco2 T C 15: 81,889,319 Y20H probably damaging Het
Adck2 T C 6: 39,583,935 V419A probably benign Het
Bahd1 T A 2: 118,916,270 N123K probably damaging Het
BC027072 T C 17: 71,752,425 K86E possibly damaging Het
Cast A G 13: 74,695,889 probably null Het
Cd164l2 T A 4: 133,223,705 V157E probably damaging Het
Cdk11b C T 4: 155,634,147 Q185* probably null Het
Ces2g T C 8: 104,967,442 F470S probably benign Het
Cherp C G 8: 72,467,980 Q313H probably damaging Het
Chrna4 A G 2: 181,033,980 V110A possibly damaging Het
Cndp2 A G 18: 84,672,124 V231A probably benign Het
Cst7 A T 2: 150,570,568 H17L probably benign Het
Decr1 C T 4: 15,919,244 D300N probably damaging Het
Dennd4b G A 3: 90,268,368 R148Q probably damaging Het
Dgkb T G 12: 38,127,364 V230G probably damaging Het
Dis3l2 T C 1: 86,973,404 V439A possibly damaging Het
Disp3 C T 4: 148,258,157 G612D probably benign Het
Dock7 T C 4: 98,944,735 T1962A probably damaging Het
Fam189a1 A G 7: 64,856,209 F96S probably damaging Het
Fibp T A 19: 5,464,199 V304E possibly damaging Het
Flt3 T A 5: 147,332,997 probably null Het
Kifc3 G A 8: 95,108,459 Q233* probably null Het
Klhl42 C A 6: 147,108,112 S483Y probably benign Het
Map3k19 G A 1: 127,834,547 R276* probably null Het
Mecom A G 3: 30,238,100 S87P probably damaging Het
Med13 A G 11: 86,327,838 V416A probably benign Het
Mepe G A 5: 104,338,212 G406D probably damaging Het
Met T G 6: 17,534,176 L673V probably benign Het
Mlh3 A T 12: 85,268,493 Y306* probably null Het
Nrxn2 C A 19: 6,490,091 A814E probably damaging Het
Nsmaf C T 4: 6,398,621 V828I probably benign Het
Olfr137 T A 17: 38,305,073 K129N possibly damaging Het
Olfr824 A T 10: 130,126,859 L66H probably damaging Het
Panx1 A G 9: 15,007,633 I310T possibly damaging Het
Pcdhb6 T A 18: 37,334,389 L121Q probably damaging Het
Plekha7 G A 7: 116,164,149 T406I probably benign Het
Prtg T C 9: 72,851,704 S447P probably damaging Het
Ptprr A G 10: 116,251,149 Y267C probably damaging Het
Rbpjl A G 2: 164,408,062 T134A probably benign Het
Rpe C A 1: 66,706,466 T55N probably damaging Het
Scn1a T C 2: 66,324,797 D606G probably benign Het
Setd5 T A 6: 113,147,502 N1105K probably benign Het
Sh3d21 T C 4: 126,162,236 N126D possibly damaging Het
Shank1 A G 7: 44,344,315 probably benign Het
Srgap3 T A 6: 112,739,078 D627V probably damaging Het
Tacc2 T A 7: 130,674,606 S1796T probably damaging Het
Tcrg-C4 A T 13: 19,352,307 R178S unknown Het
Tmco3 G A 8: 13,294,870 V217I probably damaging Het
Tspan10 A T 11: 120,444,715 Y217F possibly damaging Het
Usp3 G A 9: 66,544,021 T153M possibly damaging Het
Xdh G T 17: 73,897,764 T1067K probably benign Het
Zfp334 T C 2: 165,380,584 D513G probably benign Het
Other mutations in Accs
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01514:Accs APN 2 93839242 splice site probably benign
IGL02704:Accs APN 2 93842926 missense probably damaging 0.99
IGL02724:Accs APN 2 93845776 missense probably damaging 1.00
IGL02929:Accs APN 2 93844221 missense probably damaging 1.00
PIT4243001:Accs UTSW 2 93841334 missense probably benign
R0043:Accs UTSW 2 93841885 missense probably benign 0.03
R0644:Accs UTSW 2 93839229 missense probably damaging 1.00
R1712:Accs UTSW 2 93848103 missense probably damaging 0.96
R2215:Accs UTSW 2 93841898 missense probably benign 0.00
R4755:Accs UTSW 2 93841337 missense probably damaging 1.00
R4852:Accs UTSW 2 93844260 missense probably damaging 1.00
R4997:Accs UTSW 2 93841883 nonsense probably null
R5287:Accs UTSW 2 93835953 missense probably damaging 1.00
R5760:Accs UTSW 2 93845760 missense probably damaging 1.00
R5942:Accs UTSW 2 93836047 missense probably damaging 1.00
R5972:Accs UTSW 2 93839227 missense probably damaging 1.00
R6820:Accs UTSW 2 93842921 missense probably null 1.00
R7513:Accs UTSW 2 93840092 missense possibly damaging 0.94
R7861:Accs UTSW 2 93835732 makesense probably null
R7947:Accs UTSW 2 93844257 missense probably damaging 1.00
R8038:Accs UTSW 2 93842917 critical splice donor site probably null
R8404:Accs UTSW 2 93838115 missense probably damaging 1.00
R8502:Accs UTSW 2 93838115 missense probably damaging 1.00
Z1177:Accs UTSW 2 93848153 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGAGGAAGAGACTGCTCAC -3'
(R):5'- ATGCAACGGTGTGAAGATGC -3'

Sequencing Primer
(F):5'- GAAGAGACTGCTCACCCAGG -3'
(R):5'- GGTGTACCTGCCAGAAAACCATG -3'
Posted On2017-12-01