Mutagenetix > Incidental Mutations

Incidental Mutation 'R5615:Mtor'

501163

Institutional Source

Beutler Lab

Gene Symbol

Mtor

Ensembl Gene

ENSMUSG00000028991

Gene Name

mechanistic target of rapamycin kinase

Synonyms

RAPT1, FKBP-rapamycin-associated protein FRAP, RAFT1, flat, Frap1, 2610315D21Rik

Accession Numbers

Ncbi RefSeq: NM_020009.2; MGI:1928394

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5615 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

148448611-148557683 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 148538276 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 1938 (V1938I)

Ref Sequence

ENSEMBL: ENSMUSP00000099510 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000103221]

AlphaFold

Q9JLN9

Predicted Effect

possibly damaging
Transcript: ENSMUST00000103221
AA Change: V1938I

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000099510
Gene: ENSMUSG00000028991
AA Change: V1938I

Domain	Start	End	E-Value	Type
low complexity region	7	21	N/A	INTRINSIC
low complexity region	179	191	N/A	INTRINSIC
low complexity region	277	288	N/A	INTRINSIC
low complexity region	774	790	N/A	INTRINSIC
DUF3385	854	1024	1.51e-93	SMART
low complexity region	1279	1300	N/A	INTRINSIC
Pfam:FAT	1513	1908	2.3e-134	PFAM
Rapamycin_bind	2015	2114	7.94e-61	SMART
PI3Kc	2183	2484	8.84e-121	SMART
FATC	2517	2549	2.11e-15	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000158456

Coding Region Coverage

1x: 99.8%
3x: 99.5%
10x: 97.6%
20x: 92.4%

Validation Efficiency

MGI Phenotype

Strain: 3529989; 4820819; 3512186; 5425404; 3052669
Lethality: E11-E12
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a family of phosphatidylinositol kinase-related kinases. These kinases mediate cellular responses to stresses such as DNA damage and nutrient deprivation. This protein acts as the target for the cell-cycle arrest and immunosuppressive effects of the FKBP12-rapamycin complex. The ANGPTL7 gene is located in an intron of this gene. [provided by RefSeq, Sep 2008]
PHENOTYPE: Mice homozygous for targeted, gene trap and ENU-induced null alleles exhibit embryonic lethality by E12.5 with abnormal embryogenesis. Mice homozygous for the ENU mutation further exhibit abnormal brain development. [provided by MGI curators]

Allele List at MGI

All alleles(25) : Targeted(12) Gene trapped(12) Chemically induced(1)

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	A	T	11: 23,606,759	L407H	probably damaging	Het
Abca12	A	T	1: 71,307,059	L884H	probably damaging	Het
Ahr	A	G	12: 35,503,885	V745A	probably benign	Het
Ankrd17	A	T	5: 90,283,436	S830T	possibly damaging	Het
Aox1	A	G	1: 58,096,966	T1123A	probably benign	Het
Arhgef11	T	C	3: 87,722,485		probably null	Het
Bcas3	T	A	11: 85,470,761	C250S	probably damaging	Het
Bckdk	T	C	7: 127,907,317	I272T	probably damaging	Het
Cacna1e	T	C	1: 154,412,170	K1897E	probably damaging	Het
Cd180	A	T	13: 102,706,203	I586F	probably benign	Het
Cep290	A	G	10: 100,531,150	D1121G	probably damaging	Het
Clasrp	A	G	7: 19,586,447		probably benign	Het
Col27a1	G	T	4: 63,281,114	K912N	probably damaging	Het
Dock4	G	T	12: 40,649,480	R231L	probably benign	Het
Ell	G	A	8: 70,590,732	S505N	probably benign	Het
Ephb6	A	G	6: 41,619,291	T833A	probably benign	Het
Hemk1	T	A	9: 107,330,824		probably null	Het
Hjurp	GT	GTT	1: 88,266,524		probably null	Het
Hspa12a	T	C	19: 58,804,650	I368V	possibly damaging	Het
Igkv3-3	A	T	6: 70,687,230	T19S	probably benign	Het
Itpr1	G	A	6: 108,488,600	A2158T	possibly damaging	Het
Lancl2	T	C	6: 57,722,511	Y104H	probably damaging	Het
Leng8	G	T	7: 4,144,958	E634*	probably null	Het
Lrrk1	A	T	7: 66,287,615	C930S	probably damaging	Het
Lvrn	C	T	18: 46,850,328	S46L	possibly damaging	Het
Mcidas	G	A	13: 112,997,425	V148I	probably benign	Het
Mprip	A	T	11: 59,758,487	T1006S	probably benign	Het
Mrgprb3	T	A	7: 48,643,486	M106L	probably benign	Het
Mroh2a	GCCC	GC	1: 88,232,257		probably null	Het
Muc2	A	G	7: 141,691,203	D46G	probably damaging	Het
Nfkb2	G	T	19: 46,307,567	E170D	probably benign	Het
Olfr1113	T	A	2: 87,213,739	F282L	probably benign	Het
Olfr811	A	T	10: 129,801,767	C253S	probably damaging	Het
Osbp2	C	T	11: 3,863,356	G171D	probably benign	Het
Otud6b	A	T	4: 14,818,187	M238K	possibly damaging	Het
Pcdhac2	G	A	18: 37,146,423	G819R	probably benign	Het
Pcdhac2	G	T	18: 37,146,424	G819V	probably benign	Het
Pcdhga12	T	G	18: 37,768,079	S655A	probably damaging	Het
Pkd1l3	A	G	8: 109,630,210	I756V	probably benign	Het
Plekhd1	T	A	12: 80,720,590	S251T	probably damaging	Het
Ppp2r1a	A	T	17: 20,958,987	T96S	probably benign	Het
Qser1	A	C	2: 104,789,694	S258A	possibly damaging	Het
Rsph4a	G	A	10: 33,909,328	A412T	probably benign	Het
Sass6	T	A	3: 116,607,486	C159S	probably benign	Het
Scaf4	T	C	16: 90,251,960	Q322R	unknown	Het
Sema6d	C	T	2: 124,656,901	H244Y	probably damaging	Het
Sigirr	T	G	7: 141,092,719	L163F	probably damaging	Het
Spata31d1c	C	A	13: 65,035,264	L207I	possibly damaging	Het
Tacstd2	A	G	6: 67,535,049	F220L	probably damaging	Het
Tdpoz4	A	T	3: 93,797,499	T368S	probably benign	Het
Tnxb	C	A	17: 34,683,418	Q1082K	probably damaging	Het
Trim41	GCCTAGGCGCCCA	G	11: 48,807,365		probably benign	Het
Trpm6	C	T	19: 18,829,933	R1014C	probably damaging	Het
Ugt1a10	TTCATCA	TTCA	1: 88,216,158		probably benign	Het
Vmn2r114	ATTT	ATT	17: 23,290,932		probably null	Het
Vmn2r61	A	G	7: 42,300,493	E779G	probably damaging	Het
Vmn2r61	T	A	7: 42,267,253	M430K	probably benign	Het
Zfp599	T	C	9: 22,253,869	D70G	probably benign	Het
Zmym1	A	T	4: 127,049,398	I301N	probably damaging	Het

Other mutations in Mtor

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01123:Mtor	APN	4	148453037	missense	probably benign	0.06
IGL01447:Mtor	APN	4	148530757	missense	possibly damaging	0.62
IGL01551:Mtor	APN	4	148472037	missense	probably damaging	0.99
IGL01661:Mtor	APN	4	148514851	missense	possibly damaging	0.61
IGL01675:Mtor	APN	4	148484654	missense	probably benign	0.00
IGL01743:Mtor	APN	4	148530613	splice site	probably benign
IGL02015:Mtor	APN	4	148540113	nonsense	probably null
IGL02084:Mtor	APN	4	148470680	missense	probably damaging	0.98
IGL02095:Mtor	APN	4	148544541	missense	probably damaging	1.00
IGL02129:Mtor	APN	4	148549845	missense	possibly damaging	0.91
IGL02260:Mtor	APN	4	148538301	missense	probably damaging	1.00
IGL02329:Mtor	APN	4	148534939	missense	probably benign	0.16
IGL02440:Mtor	APN	4	148546429	missense	probably benign	0.24
IGL02440:Mtor	APN	4	148491647	missense	probably benign	0.04
IGL02449:Mtor	APN	4	148533921	missense	possibly damaging	0.65
IGL02479:Mtor	APN	4	148470584	missense	probably damaging	1.00
IGL02904:Mtor	APN	4	148452394	missense	possibly damaging	0.55
IGL02904:Mtor	APN	4	148491612	splice site	probably benign
IGL02931:Mtor	APN	4	148464964	missense	probably benign	0.22
IGL03048:Mtor	APN	4	148546390	splice site	probably benign
IGL03133:Mtor	APN	4	148484319	missense	probably benign	0.01
IGL03142:Mtor	APN	4	148453899	missense	probably benign	0.00
Dynamo	UTSW	4	148462910	missense	probably benign	0.00
engine	UTSW	4	148556855	splice site	probably null
Erg	UTSW	4	148545596	missense	probably damaging	1.00
Lindor	UTSW	4	148454646	missense	probably damaging	1.00
motor	UTSW	4	148491360	missense	possibly damaging	0.76
R4858_Mtor_211	UTSW	4	148454816	makesense	probably null
Vim	UTSW	4	148525803	critical splice donor site	probably null
PIT4519001:Mtor	UTSW	4	148524500	missense	probably damaging	1.00
R0045:Mtor	UTSW	4	148464949	missense	probably benign	0.42
R0048:Mtor	UTSW	4	148538881	nonsense	probably null
R0048:Mtor	UTSW	4	148538881	nonsense	probably null
R0103:Mtor	UTSW	4	148533902	missense	probably benign	0.05
R0112:Mtor	UTSW	4	148480923	missense	probably damaging	1.00
R0137:Mtor	UTSW	4	148470624	missense	possibly damaging	0.78
R0184:Mtor	UTSW	4	148464971	missense	probably benign	0.05
R0208:Mtor	UTSW	4	148464975	missense	probably benign	0.43
R0329:Mtor	UTSW	4	148484380	missense	probably benign
R0330:Mtor	UTSW	4	148484380	missense	probably benign
R0365:Mtor	UTSW	4	148486050	missense	probably benign	0.01
R0537:Mtor	UTSW	4	148538360	missense	probably damaging	1.00
R0542:Mtor	UTSW	4	148540450	missense	probably benign	0.02
R0556:Mtor	UTSW	4	148469380	missense	possibly damaging	0.88
R0613:Mtor	UTSW	4	148526046	missense	possibly damaging	0.95
R0646:Mtor	UTSW	4	148484354	nonsense	probably null
R0710:Mtor	UTSW	4	148464391	missense	possibly damaging	0.73
R0791:Mtor	UTSW	4	148462910	missense	probably benign	0.00
R0792:Mtor	UTSW	4	148462910	missense	probably benign	0.00
R0866:Mtor	UTSW	4	148486056	missense	probably benign	0.04
R0973:Mtor	UTSW	4	148550188	missense	probably damaging	1.00
R1027:Mtor	UTSW	4	148539999	missense	probably benign	0.03
R1028:Mtor	UTSW	4	148538830	missense	possibly damaging	0.88
R1289:Mtor	UTSW	4	148470307	missense	probably benign	0.10
R1416:Mtor	UTSW	4	148491414	nonsense	probably null
R1465:Mtor	UTSW	4	148525993	splice site	probably benign
R1506:Mtor	UTSW	4	148536505	splice site	probably benign
R1624:Mtor	UTSW	4	148547676	missense	probably damaging	1.00
R1695:Mtor	UTSW	4	148538907	missense	probably benign	0.08
R1771:Mtor	UTSW	4	148470624	missense	possibly damaging	0.78
R1800:Mtor	UTSW	4	148462892	missense	probably benign	0.00
R1855:Mtor	UTSW	4	148553089	missense	probably benign	0.02
R1857:Mtor	UTSW	4	148480879	missense	probably damaging	1.00
R1867:Mtor	UTSW	4	148454632	missense	probably damaging	0.97
R1954:Mtor	UTSW	4	148468273	missense	probably damaging	1.00
R2054:Mtor	UTSW	4	148462852	missense	probably benign	0.05
R2054:Mtor	UTSW	4	148466025	missense	probably benign	0.00
R2099:Mtor	UTSW	4	148550192	nonsense	probably null
R2148:Mtor	UTSW	4	148456012	missense	possibly damaging	0.56
R2214:Mtor	UTSW	4	148538870	missense	probably benign	0.39
R2281:Mtor	UTSW	4	148489555	missense	probably benign	0.02
R2512:Mtor	UTSW	4	148530491	missense	possibly damaging	0.95
R2870:Mtor	UTSW	4	148540030	missense	probably benign	0.00
R2870:Mtor	UTSW	4	148540030	missense	probably benign	0.00
R2871:Mtor	UTSW	4	148540030	missense	probably benign	0.00
R2871:Mtor	UTSW	4	148540030	missense	probably benign	0.00
R2872:Mtor	UTSW	4	148540030	missense	probably benign	0.00
R2872:Mtor	UTSW	4	148540030	missense	probably benign	0.00
R2873:Mtor	UTSW	4	148540030	missense	probably benign	0.00
R4032:Mtor	UTSW	4	148536752	missense	probably benign	0.03
R4073:Mtor	UTSW	4	148549375	missense	probably damaging	0.99
R4273:Mtor	UTSW	4	148550152	missense	probably benign	0.21
R4611:Mtor	UTSW	4	148486119	missense	probably benign	0.03
R4858:Mtor	UTSW	4	148454816	makesense	probably null
R4942:Mtor	UTSW	4	148472142	missense	probably benign	0.03
R4967:Mtor	UTSW	4	148491360	missense	possibly damaging	0.76
R4995:Mtor	UTSW	4	148525752	missense	probably damaging	1.00
R5054:Mtor	UTSW	4	148556855	splice site	probably null
R5215:Mtor	UTSW	4	148453983	missense	probably benign
R5249:Mtor	UTSW	4	148463732	missense	probably damaging	1.00
R5289:Mtor	UTSW	4	148466092	missense	possibly damaging	0.88
R5365:Mtor	UTSW	4	148550130	missense	probably damaging	0.99
R5498:Mtor	UTSW	4	148540364	missense	possibly damaging	0.71
R5514:Mtor	UTSW	4	148546444	missense	probably damaging	1.00
R5540:Mtor	UTSW	4	148454708	missense	probably benign	0.01
R5600:Mtor	UTSW	4	148491470	missense	probably damaging	1.00
R5632:Mtor	UTSW	4	148469006	missense	possibly damaging	0.94
R5641:Mtor	UTSW	4	148546425	missense	probably damaging	0.98
R5834:Mtor	UTSW	4	148536536	missense	possibly damaging	0.95
R5984:Mtor	UTSW	4	148538827	missense	probably benign	0.02
R6056:Mtor	UTSW	4	148537435	missense	probably benign	0.00
R6225:Mtor	UTSW	4	148521337	missense	probably benign	0.04
R6262:Mtor	UTSW	4	148526095	missense	possibly damaging	0.46
R6335:Mtor	UTSW	4	148465927	missense	probably damaging	1.00
R6479:Mtor	UTSW	4	148551000	missense	probably benign	0.16
R6543:Mtor	UTSW	4	148545596	missense	probably damaging	1.00
R6711:Mtor	UTSW	4	148452367	missense	possibly damaging	0.49
R6715:Mtor	UTSW	4	148538547	missense	probably benign	0.00
R6744:Mtor	UTSW	4	148458655	missense	probably benign	0.01
R6748:Mtor	UTSW	4	148550184	missense	probably damaging	1.00
R6762:Mtor	UTSW	4	148538481	missense	possibly damaging	0.47
R6836:Mtor	UTSW	4	148489498	missense	possibly damaging	0.94
R6948:Mtor	UTSW	4	148536752	missense	probably benign	0.12
R6979:Mtor	UTSW	4	148524473	missense	possibly damaging	0.60
R6992:Mtor	UTSW	4	148464475	missense	probably benign
R7271:Mtor	UTSW	4	148546485	missense	possibly damaging	0.70
R7423:Mtor	UTSW	4	148556344	missense	possibly damaging	0.77
R7434:Mtor	UTSW	4	148464959	missense	probably benign	0.39
R7619:Mtor	UTSW	4	148462795	missense	probably damaging	0.98
R7634:Mtor	UTSW	4	148452350	missense	possibly damaging	0.53
R7697:Mtor	UTSW	4	148540308	nonsense	probably null
R7737:Mtor	UTSW	4	148538738	missense	possibly damaging	0.95
R7791:Mtor	UTSW	4	148462940	missense	probably benign	0.00
R7858:Mtor	UTSW	4	148454646	missense	probably damaging	1.00
R8035:Mtor	UTSW	4	148546399	missense	probably benign	0.29
R8076:Mtor	UTSW	4	148525803	critical splice donor site	probably null
R8078:Mtor	UTSW	4	148468287	missense	probably benign
R8928:Mtor	UTSW	4	148538899	missense	probably damaging	1.00
R9040:Mtor	UTSW	4	148463748	missense	probably benign	0.00
R9116:Mtor	UTSW	4	148552741	missense	probably benign
R9284:Mtor	UTSW	4	148459080	missense	probably benign	0.03
R9310:Mtor	UTSW	4	148469377	missense	probably benign	0.03
R9374:Mtor	UTSW	4	148514940	missense	probably damaging	1.00
R9417:Mtor	UTSW	4	148538319	nonsense	probably null
X0025:Mtor	UTSW	4	148530714	missense	probably benign	0.09
Z1176:Mtor	UTSW	4	148550125	missense	probably benign	0.08
Z1176:Mtor	UTSW	4	148550130	missense	possibly damaging	0.69

Predicted Primers

PCR Primer
(F):5'- GGTTCCAAGCTCCAAACCAG -3'
(R):5'- ACTTGTAAAGGCGAGCCACC -3'

Sequencing Primer
(F):5'- TGGGTACACCATTTCAAGACCTG -3'
(R):5'- ACCAAAGCAACAGTCAGTGG -3'

Posted On

2017-12-01