Incidental Mutation 'R5615:Vmn2r114'
ID 501164
Institutional Source Beutler Lab
Gene Symbol Vmn2r114
Ensembl Gene ENSMUSG00000091945
Gene Name vomeronasal 2, receptor 114
Synonyms EG666002
Accession Numbers
Essential gene? Probably non essential (E-score: 0.142) question?
Stock # R5615 (G1)
Quality Score 144
Status Not validated
Chromosome 17
Chromosomal Location 23509908-23531287 bp(-) (GRCm39)
Type of Mutation makesense
DNA Base Change (assembly) ATTT to ATT at 23509906 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000127505 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168033]
AlphaFold E9Q281
Predicted Effect probably null
Transcript: ENSMUST00000168033
SMART Domains Protein: ENSMUSP00000127505
Gene: ENSMUSG00000091945

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 154 470 1.5e-24 PFAM
Pfam:NCD3G 511 564 1.5e-18 PFAM
Pfam:7tm_3 597 832 1.4e-55 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A T 1: 71,346,218 (GRCm39) L884H probably damaging Het
Ahr A G 12: 35,553,884 (GRCm39) V745A probably benign Het
Ankrd17 A T 5: 90,431,295 (GRCm39) S830T possibly damaging Het
Aox1 A G 1: 58,136,125 (GRCm39) T1123A probably benign Het
Arhgef11 T C 3: 87,629,792 (GRCm39) probably null Het
Bcas3 T A 11: 85,361,587 (GRCm39) C250S probably damaging Het
Bckdk T C 7: 127,506,489 (GRCm39) I272T probably damaging Het
Cacna1e T C 1: 154,287,916 (GRCm39) K1897E probably damaging Het
Cd180 A T 13: 102,842,711 (GRCm39) I586F probably benign Het
Cep290 A G 10: 100,367,012 (GRCm39) D1121G probably damaging Het
Clasrp A G 7: 19,320,372 (GRCm39) probably benign Het
Col27a1 G T 4: 63,199,351 (GRCm39) K912N probably damaging Het
Dock4 G T 12: 40,699,479 (GRCm39) R231L probably benign Het
Ell G A 8: 71,043,382 (GRCm39) S505N probably benign Het
Ephb6 A G 6: 41,596,225 (GRCm39) T833A probably benign Het
Hemk1 T A 9: 107,208,023 (GRCm39) probably null Het
Hjurp GT GTT 1: 88,194,246 (GRCm39) probably null Het
Hspa12a T C 19: 58,793,082 (GRCm39) I368V possibly damaging Het
Igkv3-3 A T 6: 70,664,214 (GRCm39) T19S probably benign Het
Itpr1 G A 6: 108,465,561 (GRCm39) A2158T possibly damaging Het
Lancl2 T C 6: 57,699,496 (GRCm39) Y104H probably damaging Het
Leng8 G T 7: 4,147,957 (GRCm39) E634* probably null Het
Lrrk1 A T 7: 65,937,363 (GRCm39) C930S probably damaging Het
Lvrn C T 18: 46,983,395 (GRCm39) S46L possibly damaging Het
Mcidas G A 13: 113,133,959 (GRCm39) V148I probably benign Het
Mprip A T 11: 59,649,313 (GRCm39) T1006S probably benign Het
Mrgprb3 T A 7: 48,293,234 (GRCm39) M106L probably benign Het
Mroh2a GCCC GC 1: 88,159,979 (GRCm39) probably null Het
Mtor G A 4: 148,622,733 (GRCm39) V1938I possibly damaging Het
Muc2 A G 7: 141,277,446 (GRCm39) D46G probably damaging Het
Nfkb2 G T 19: 46,296,006 (GRCm39) E170D probably benign Het
Or10ag52 T A 2: 87,044,083 (GRCm39) F282L probably benign Het
Or6c215 A T 10: 129,637,636 (GRCm39) C253S probably damaging Het
Osbp2 C T 11: 3,813,356 (GRCm39) G171D probably benign Het
Otud6b A T 4: 14,818,187 (GRCm39) M238K possibly damaging Het
Pcdhac2 G A 18: 37,279,476 (GRCm39) G819R probably benign Het
Pcdhac2 G T 18: 37,279,477 (GRCm39) G819V probably benign Het
Pcdhga12 T G 18: 37,901,132 (GRCm39) S655A probably damaging Het
Pkd1l3 A G 8: 110,356,842 (GRCm39) I756V probably benign Het
Plekhd1 T A 12: 80,767,364 (GRCm39) S251T probably damaging Het
Ppp2r1a A T 17: 21,179,249 (GRCm39) T96S probably benign Het
Qser1 A C 2: 104,620,039 (GRCm39) S258A possibly damaging Het
Rsph4a G A 10: 33,785,324 (GRCm39) A412T probably benign Het
Sanbr A T 11: 23,556,759 (GRCm39) L407H probably damaging Het
Sass6 T A 3: 116,401,135 (GRCm39) C159S probably benign Het
Scaf4 T C 16: 90,048,848 (GRCm39) Q322R unknown Het
Sema6d C T 2: 124,498,821 (GRCm39) H244Y probably damaging Het
Sigirr T G 7: 140,672,632 (GRCm39) L163F probably damaging Het
Spata31d1c C A 13: 65,183,078 (GRCm39) L207I possibly damaging Het
Tacstd2 A G 6: 67,512,033 (GRCm39) F220L probably damaging Het
Tdpoz4 A T 3: 93,704,806 (GRCm39) T368S probably benign Het
Tnxb C A 17: 34,902,392 (GRCm39) Q1082K probably damaging Het
Trim41 GCCTAGGCGCCCA G 11: 48,698,192 (GRCm39) probably benign Het
Trpm6 C T 19: 18,807,297 (GRCm39) R1014C probably damaging Het
Ugt1a10 TTCATCA TTCA 1: 88,143,880 (GRCm39) probably benign Het
Vmn2r61 T A 7: 41,916,677 (GRCm39) M430K probably benign Het
Vmn2r61 A G 7: 41,949,917 (GRCm39) E779G probably damaging Het
Zfp599 T C 9: 22,165,165 (GRCm39) D70G probably benign Het
Zmym1 A T 4: 126,943,191 (GRCm39) I301N probably damaging Het
Other mutations in Vmn2r114
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Vmn2r114 APN 17 23,510,639 (GRCm39) missense probably damaging 1.00
IGL00990:Vmn2r114 APN 17 23,510,212 (GRCm39) missense probably damaging 1.00
IGL00990:Vmn2r114 APN 17 23,509,957 (GRCm39) missense probably benign 0.23
IGL00990:Vmn2r114 APN 17 23,509,939 (GRCm39) missense probably benign
IGL01838:Vmn2r114 APN 17 23,515,956 (GRCm39) missense probably benign 0.44
IGL01990:Vmn2r114 APN 17 23,529,355 (GRCm39) missense probably benign 0.22
IGL01994:Vmn2r114 APN 17 23,529,451 (GRCm39) missense probably damaging 1.00
IGL02153:Vmn2r114 APN 17 23,510,782 (GRCm39) missense probably benign 0.01
IGL02453:Vmn2r114 APN 17 23,530,108 (GRCm39) missense probably benign 0.00
IGL02621:Vmn2r114 APN 17 23,529,494 (GRCm39) missense probably damaging 0.98
IGL02938:Vmn2r114 APN 17 23,510,263 (GRCm39) missense probably benign 0.10
IGL03130:Vmn2r114 APN 17 23,515,970 (GRCm39) splice site probably benign
IGL03325:Vmn2r114 APN 17 23,510,652 (GRCm39) missense probably damaging 1.00
BB004:Vmn2r114 UTSW 17 23,510,619 (GRCm39) missense probably damaging 1.00
R0109:Vmn2r114 UTSW 17 23,529,549 (GRCm39) nonsense probably null
R0164:Vmn2r114 UTSW 17 23,528,800 (GRCm39) critical splice donor site probably null
R0310:Vmn2r114 UTSW 17 23,509,917 (GRCm39) missense probably benign 0.23
R0583:Vmn2r114 UTSW 17 23,509,906 (GRCm39) makesense probably null
R0677:Vmn2r114 UTSW 17 23,529,568 (GRCm39) missense probably damaging 1.00
R1127:Vmn2r114 UTSW 17 23,509,906 (GRCm39) makesense probably null
R1147:Vmn2r114 UTSW 17 23,530,037 (GRCm39) missense probably benign 0.00
R1147:Vmn2r114 UTSW 17 23,530,037 (GRCm39) missense probably benign 0.00
R1157:Vmn2r114 UTSW 17 23,529,314 (GRCm39) missense possibly damaging 0.60
R1323:Vmn2r114 UTSW 17 23,509,906 (GRCm39) makesense probably null
R1347:Vmn2r114 UTSW 17 23,509,906 (GRCm39) makesense probably null
R1435:Vmn2r114 UTSW 17 23,509,906 (GRCm39) makesense probably null
R1437:Vmn2r114 UTSW 17 23,510,185 (GRCm39) missense probably damaging 1.00
R1585:Vmn2r114 UTSW 17 23,510,675 (GRCm39) missense probably damaging 0.98
R1641:Vmn2r114 UTSW 17 23,515,962 (GRCm39) missense probably benign 0.00
R1748:Vmn2r114 UTSW 17 23,527,035 (GRCm39) missense probably benign 0.17
R1954:Vmn2r114 UTSW 17 23,530,086 (GRCm39) missense probably benign 0.32
R2081:Vmn2r114 UTSW 17 23,510,083 (GRCm39) missense possibly damaging 0.91
R2103:Vmn2r114 UTSW 17 23,509,906 (GRCm39) makesense probably null
R2113:Vmn2r114 UTSW 17 23,509,906 (GRCm39) makesense probably null
R2134:Vmn2r114 UTSW 17 23,510,737 (GRCm39) missense probably damaging 1.00
R2149:Vmn2r114 UTSW 17 23,509,906 (GRCm39) makesense probably null
R2424:Vmn2r114 UTSW 17 23,515,842 (GRCm39) missense possibly damaging 0.90
R2847:Vmn2r114 UTSW 17 23,509,948 (GRCm39) missense probably benign 0.00
R2848:Vmn2r114 UTSW 17 23,509,948 (GRCm39) missense probably benign 0.00
R2893:Vmn2r114 UTSW 17 23,509,906 (GRCm39) makesense probably null
R3017:Vmn2r114 UTSW 17 23,509,906 (GRCm39) makesense probably null
R3018:Vmn2r114 UTSW 17 23,509,906 (GRCm39) makesense probably null
R3019:Vmn2r114 UTSW 17 23,509,906 (GRCm39) makesense probably null
R3020:Vmn2r114 UTSW 17 23,509,906 (GRCm39) makesense probably null
R3021:Vmn2r114 UTSW 17 23,509,906 (GRCm39) makesense probably null
R4628:Vmn2r114 UTSW 17 23,509,906 (GRCm39) makesense probably null
R4668:Vmn2r114 UTSW 17 23,529,447 (GRCm39) missense possibly damaging 0.83
R4840:Vmn2r114 UTSW 17 23,510,353 (GRCm39) missense probably damaging 0.97
R4841:Vmn2r114 UTSW 17 23,529,336 (GRCm39) missense probably benign 0.04
R4842:Vmn2r114 UTSW 17 23,529,336 (GRCm39) missense probably benign 0.04
R4856:Vmn2r114 UTSW 17 23,527,008 (GRCm39) missense probably benign 0.11
R4886:Vmn2r114 UTSW 17 23,527,008 (GRCm39) missense probably benign 0.11
R4992:Vmn2r114 UTSW 17 23,510,765 (GRCm39) missense probably benign 0.03
R5182:Vmn2r114 UTSW 17 23,510,632 (GRCm39) missense probably damaging 0.96
R5223:Vmn2r114 UTSW 17 23,509,906 (GRCm39) makesense probably null
R5405:Vmn2r114 UTSW 17 23,509,906 (GRCm39) makesense probably null
R5449:Vmn2r114 UTSW 17 23,509,906 (GRCm39) makesense probably null
R5834:Vmn2r114 UTSW 17 23,529,599 (GRCm39) missense possibly damaging 0.90
R6150:Vmn2r114 UTSW 17 23,510,269 (GRCm39) missense probably benign 0.03
R6277:Vmn2r114 UTSW 17 23,509,954 (GRCm39) missense possibly damaging 0.93
R6403:Vmn2r114 UTSW 17 23,528,939 (GRCm39) missense probably damaging 0.99
R6589:Vmn2r114 UTSW 17 23,510,642 (GRCm39) missense probably damaging 1.00
R6613:Vmn2r114 UTSW 17 23,529,220 (GRCm39) missense possibly damaging 0.82
R6747:Vmn2r114 UTSW 17 23,528,850 (GRCm39) missense probably benign 0.00
R6837:Vmn2r114 UTSW 17 23,529,176 (GRCm39) missense probably benign 0.10
R6911:Vmn2r114 UTSW 17 23,510,104 (GRCm39) missense probably damaging 0.98
R6950:Vmn2r114 UTSW 17 23,529,137 (GRCm39) missense probably benign 0.03
R7276:Vmn2r114 UTSW 17 23,509,934 (GRCm39) missense probably damaging 0.97
R7482:Vmn2r114 UTSW 17 23,510,468 (GRCm39) missense probably damaging 1.00
R7514:Vmn2r114 UTSW 17 23,527,035 (GRCm39) missense probably null 0.96
R7523:Vmn2r114 UTSW 17 23,529,611 (GRCm39) missense probably benign 0.01
R7563:Vmn2r114 UTSW 17 23,510,000 (GRCm39) missense probably benign 0.01
R7585:Vmn2r114 UTSW 17 23,510,239 (GRCm39) missense probably damaging 1.00
R7593:Vmn2r114 UTSW 17 23,510,817 (GRCm39) nonsense probably null
R7611:Vmn2r114 UTSW 17 23,515,944 (GRCm39) missense probably damaging 0.97
R7641:Vmn2r114 UTSW 17 23,527,177 (GRCm39) missense possibly damaging 0.53
R7651:Vmn2r114 UTSW 17 23,509,986 (GRCm39) nonsense probably null
R7970:Vmn2r114 UTSW 17 23,530,186 (GRCm39) missense probably benign 0.00
R8737:Vmn2r114 UTSW 17 23,529,142 (GRCm39) missense probably benign 0.36
R8802:Vmn2r114 UTSW 17 23,528,836 (GRCm39) missense possibly damaging 0.65
R8847:Vmn2r114 UTSW 17 23,528,986 (GRCm39) missense probably damaging 1.00
R8991:Vmn2r114 UTSW 17 23,529,286 (GRCm39) missense probably damaging 1.00
R9138:Vmn2r114 UTSW 17 23,510,578 (GRCm39) missense probably damaging 1.00
R9173:Vmn2r114 UTSW 17 23,510,527 (GRCm39) missense probably damaging 0.99
R9175:Vmn2r114 UTSW 17 23,527,212 (GRCm39) missense probably damaging 1.00
R9657:Vmn2r114 UTSW 17 23,510,690 (GRCm39) missense probably damaging 1.00
R9670:Vmn2r114 UTSW 17 23,531,098 (GRCm39) missense
X0065:Vmn2r114 UTSW 17 23,529,931 (GRCm39) missense probably benign 0.34
Z1088:Vmn2r114 UTSW 17 23,509,906 (GRCm39) makesense probably null
Predicted Primers PCR Primer
(F):5'- CTCCCAGTGTAAAGATTTTGTCAC -3'
(R):5'- TTACCATAGCACCAAAGGCAGG -3'

Sequencing Primer
(F):5'- CAGGCCATGATTATATCTGCAGAGAC -3'
(R):5'- CACCAAAGGCAGGGTCATG -3'
Posted On 2017-12-01