Incidental Mutation 'R5545:Vnn3'
ID501180
Institutional Source Beutler Lab
Gene Symbol Vnn3
Ensembl Gene ENSMUSG00000020010
Gene Namevanin 3
Synonyms
MMRRC Submission 043103-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R5545 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location23851462-23869843 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 23867094 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 401 (I401V)
Ref Sequence ENSEMBL: ENSMUSP00000020190 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020190]
Predicted Effect probably benign
Transcript: ENSMUST00000020190
AA Change: I401V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000020190
Gene: ENSMUSG00000020010
AA Change: I401V

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:CN_hydrolase 51 296 6.9e-19 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004B18Rik T C 3: 145,939,098 probably null Het
Acot5 G A 12: 84,069,606 R47Q possibly damaging Het
Akr1c19 A T 13: 4,242,595 Y205F probably benign Het
Cdh6 T C 15: 13,041,149 Y564C probably damaging Het
Cngb1 A G 8: 95,252,173 S551P probably damaging Het
Cyp20a1 T C 1: 60,376,082 I289T possibly damaging Het
Gm17677 A G 9: 35,741,644 I61V probably benign Het
Herc6 A T 6: 57,658,007 probably null Het
Ifnar2 G A 16: 91,385,025 probably null Het
Kcnd2 A G 6: 21,217,019 T241A probably damaging Het
Nfatc2ip T A 7: 126,390,470 E247D possibly damaging Het
Olfr1394 G A 11: 49,160,626 C204Y probably damaging Het
Olfr267 T G 4: 58,785,585 I46L probably benign Het
Plekhg2 T C 7: 28,362,461 E638G probably damaging Het
Plin1 T C 7: 79,726,509 T160A probably benign Het
Prox1 T A 1: 190,147,142 N613I probably damaging Het
Ptpn13 A G 5: 103,561,964 S1498G probably damaging Het
Ralbp1 C T 17: 65,850,104 R598Q possibly damaging Het
Robo2 A C 16: 73,961,747 V712G probably damaging Het
Rsl1d1 A G 16: 11,199,650 F151L probably damaging Het
Scrn3 T A 2: 73,335,781 I386N possibly damaging Het
Sorl1 T A 9: 41,991,625 Y1591F probably benign Het
Tbr1 T G 2: 61,807,376 V93G possibly damaging Het
Tmem229b A G 12: 78,964,809 I116T probably damaging Het
Ttn T C 2: 76,764,376 Q12115R possibly damaging Het
Ube3a C T 7: 59,272,024 T48M probably damaging Het
Wdr90 C T 17: 25,845,856 R1744H probably damaging Het
Zc3h7a T C 16: 11,148,451 D604G possibly damaging Het
Other mutations in Vnn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00675:Vnn3 APN 10 23867168 missense possibly damaging 0.77
IGL01300:Vnn3 APN 10 23864365 missense possibly damaging 0.87
IGL01349:Vnn3 APN 10 23851916 missense probably damaging 0.99
IGL02491:Vnn3 APN 10 23865918 missense probably benign 0.11
IGL03256:Vnn3 APN 10 23851800 splice site probably benign
IGL03289:Vnn3 APN 10 23865837 missense possibly damaging 0.92
IGL02799:Vnn3 UTSW 10 23851971 missense possibly damaging 0.64
R0599:Vnn3 UTSW 10 23865705 missense possibly damaging 0.94
R1703:Vnn3 UTSW 10 23865930 missense probably benign
R1753:Vnn3 UTSW 10 23865820 missense probably benign 0.27
R2119:Vnn3 UTSW 10 23864413 missense probably damaging 1.00
R2288:Vnn3 UTSW 10 23864456 missense probably benign 0.03
R4255:Vnn3 UTSW 10 23865822 missense probably benign 0.18
R4458:Vnn3 UTSW 10 23865669 missense probably benign 0.23
R4518:Vnn3 UTSW 10 23867226 missense possibly damaging 0.77
R4545:Vnn3 UTSW 10 23856326 missense probably benign 0.00
R4723:Vnn3 UTSW 10 23851691 missense possibly damaging 0.88
R4791:Vnn3 UTSW 10 23864621 missense probably benign
R4921:Vnn3 UTSW 10 23864575 missense probably benign 0.01
R5152:Vnn3 UTSW 10 23864339 missense probably benign 0.01
R5390:Vnn3 UTSW 10 23851585 start codon destroyed probably null 1.00
R6197:Vnn3 UTSW 10 23856289 missense probably damaging 1.00
R6751:Vnn3 UTSW 10 23869625 missense probably benign 0.00
R6846:Vnn3 UTSW 10 23851722 missense probably benign
R6917:Vnn3 UTSW 10 23865934 missense possibly damaging 0.50
R7073:Vnn3 UTSW 10 23864413 missense probably damaging 1.00
R7100:Vnn3 UTSW 10 23865942 missense probably damaging 1.00
R7152:Vnn3 UTSW 10 23851615 missense possibly damaging 0.88
R7336:Vnn3 UTSW 10 23851908 missense probably benign 0.42
R7421:Vnn3 UTSW 10 23865768 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- GGCTGACCTTTAAAATTCTGTTGAC -3'
(R):5'- TGTATCCCCTTGAAGGCCTC -3'

Sequencing Primer
(F):5'- ACCAGGTCTACAGAGTGAGTTTCC -3'
(R):5'- CTTACTTCATAATATCTTTCCAGGGC -3'
Posted On2017-12-01