Incidental Mutation 'R5532:Ndufb7'
ID501183
Institutional Source Beutler Lab
Gene Symbol Ndufb7
Ensembl Gene ENSMUSG00000033938
Gene NameNADH dehydrogenase (ubiquinone) 1 beta subcomplex, 7
Synonyms
MMRRC Submission 043090-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.951) question?
Stock #R5532 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location83566671-83571626 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 83571434 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 95 (Y95N)
Ref Sequence ENSEMBL: ENSMUSP00000037341 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019382] [ENSMUST00000036996] [ENSMUST00000163837] [ENSMUST00000165740] [ENSMUST00000212005] [ENSMUST00000212630] [ENSMUST00000212703] [ENSMUST00000212990]
Predicted Effect probably benign
Transcript: ENSMUST00000019382
SMART Domains Protein: ENSMUSP00000019382
Gene: ENSMUSG00000031708

DomainStartEndE-ValueType
PDB:2DZJ|A 1 81 2e-49 PDB
Blast:UBQ 5 81 8e-13 BLAST
transmembrane domain 85 107 N/A INTRINSIC
Pfam:Steroid_dh 154 308 3.4e-32 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000036996
AA Change: Y95N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000037341
Gene: ENSMUSG00000033938
AA Change: Y95N

DomainStartEndE-ValueType
Pfam:NDUF_B7 40 102 3.8e-32 PFAM
low complexity region 103 136 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127162
Predicted Effect probably benign
Transcript: ENSMUST00000163837
SMART Domains Protein: ENSMUSP00000128329
Gene: ENSMUSG00000031708

DomainStartEndE-ValueType
PDB:2DZJ|A 1 135 2e-27 PDB
Blast:UBQ 91 135 1e-7 BLAST
transmembrane domain 139 161 N/A INTRINSIC
Pfam:Steroid_dh 208 362 6e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165740
SMART Domains Protein: ENSMUSP00000131389
Gene: ENSMUSG00000031708

DomainStartEndE-ValueType
PDB:2DZJ|A 1 66 1e-31 PDB
transmembrane domain 70 92 N/A INTRINSIC
Pfam:Steroid_dh 139 293 3.6e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211972
Predicted Effect probably benign
Transcript: ENSMUST00000212005
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212132
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212136
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212187
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212285
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212418
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212575
Predicted Effect probably benign
Transcript: ENSMUST00000212630
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212652
Predicted Effect probably benign
Transcript: ENSMUST00000212703
Predicted Effect probably benign
Transcript: ENSMUST00000212990
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of the multisubunit NADH:ubiquinone oxidoreductase (complex I). Mammalian complex I is composed of 45 different subunits. It is located at the mitochondrial inner membrane. This protein has NADH dehydrogenase activity and oxidoreductase activity. It transfers electrons from NADH to the respiratory chain. The immediate electron acceptor for the enzyme is believed to be ubiquinone. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410141K09Rik A T 13: 66,431,681 C248S probably damaging Het
A2ml1 T A 6: 128,553,330 probably null Het
Adsl C G 15: 80,963,909 P118A probably damaging Het
Ano6 C T 15: 95,962,241 P748L probably damaging Het
Arhgap10 A T 8: 77,420,072 N234K probably benign Het
Arhgap18 T A 10: 26,846,108 I25K possibly damaging Het
AW551984 T C 9: 39,597,185 Y345C probably damaging Het
Ccdc146 A G 5: 21,305,331 V561A probably benign Het
Cenpv G A 11: 62,527,572 T185M probably damaging Het
Fat2 T A 11: 55,262,337 D3683V probably damaging Het
Galns T C 8: 122,585,026 D415G possibly damaging Het
Gatad2a G A 8: 69,916,420 T259M probably damaging Het
Gja8 T C 3: 96,920,332 S5G probably benign Het
Gm13119 A T 4: 144,363,491 D367V probably damaging Het
Gm4951 A G 18: 60,246,070 I226V probably benign Het
Ifi209 T C 1: 173,638,976 S125P probably damaging Het
Il12rb2 G A 6: 67,292,262 R856W probably damaging Het
Kcnq3 A T 15: 65,997,773 Y605* probably null Het
Klk1b16 T C 7: 44,141,526 S251P probably benign Het
Map2 A G 1: 66,414,620 N890D probably damaging Het
Map4 T A 9: 110,034,678 S324T probably benign Het
Mmp28 T C 11: 83,442,858 D419G probably damaging Het
Mtnr1b A G 9: 15,862,914 L283P probably benign Het
Nfrkb C T 9: 31,397,779 R280W probably damaging Het
Npc1l1 A G 11: 6,224,245 Y687H probably damaging Het
Olfr1099 T A 2: 86,958,580 R293* probably null Het
Olfr308 A C 7: 86,321,671 F94V possibly damaging Het
Olfr889 C T 9: 38,116,627 T277I probably benign Het
Olfr919 T C 9: 38,697,647 T240A probably damaging Het
Pabpc4l T C 3: 46,446,609 D200G probably benign Het
Plekhg6 T C 6: 125,372,551 E361G possibly damaging Het
Rictor A G 15: 6,789,565 Y1423C probably damaging Het
Rsf1 G A 7: 97,680,695 D1143N probably damaging Het
Spsb4 C T 9: 96,995,574 probably null Het
Strada G T 11: 106,171,017 A136E probably damaging Het
Syce2 A T 8: 84,883,502 Q73L probably damaging Het
Teddm2 A T 1: 153,850,384 V195D probably benign Het
Tex36 A T 7: 133,601,983 N12K probably benign Het
Ubtf A G 11: 102,308,959 S484P probably benign Het
Ufd1 T G 16: 18,817,930 L66R probably damaging Het
Vmn2r74 C T 7: 85,951,989 A814T probably benign Het
Vmn2r98 T C 17: 19,067,383 S493P possibly damaging Het
Xrcc1 T A 7: 24,567,928 probably null Het
Zfp277 A C 12: 40,335,309 C305G probably damaging Het
Other mutations in Ndufb7
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2204:Ndufb7 UTSW 8 83570899 missense probably damaging 1.00
R4603:Ndufb7 UTSW 8 83566865 missense probably damaging 0.98
R4620:Ndufb7 UTSW 8 83566858 missense probably damaging 0.99
R4916:Ndufb7 UTSW 8 83570905 missense probably damaging 1.00
R5039:Ndufb7 UTSW 8 83571465 unclassified probably benign
R5120:Ndufb7 UTSW 8 83566977 unclassified probably benign
R5968:Ndufb7 UTSW 8 83566901 missense probably benign 0.03
R7117:Ndufb7 UTSW 8 83570861 missense probably benign 0.11
R7456:Ndufb7 UTSW 8 83566853 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CTCAGCTATCCACACCTCGG -3'
(R):5'- AGGTGACCCAAAGCTTTTATTTCAC -3'

Sequencing Primer
(F):5'- TATCCACACCTCGGCCACC -3'
(R):5'- ATTTCACTGATAGGTCCACAGGCTG -3'
Posted On2017-12-01