Incidental Mutation 'R0130:Rbfox2'
ID 50120
Institutional Source Beutler Lab
Gene Symbol Rbfox2
Ensembl Gene ENSMUSG00000033565
Gene Name RNA binding protein, fox-1 homolog (C. elegans) 2
Synonyms Rbm9, 2810460A15Rik, Fxh, Fbm2
MMRRC Submission 038415-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.580) question?
Stock # R0130 (G1)
Quality Score 144
Status Validated (trace)
Chromosome 15
Chromosomal Location 76963190-77191204 bp(-) (GRCm39)
Type of Mutation intron
DNA Base Change (assembly) A to G at 76976057 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153751 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048145] [ENSMUST00000111581] [ENSMUST00000166610] [ENSMUST00000171751] [ENSMUST00000227314] [ENSMUST00000227930] [ENSMUST00000227533] [ENSMUST00000228087]
AlphaFold Q8BP71
Predicted Effect probably benign
Transcript: ENSMUST00000048145
SMART Domains Protein: ENSMUSP00000048056
Gene: ENSMUSG00000033565

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
low complexity region 91 107 N/A INTRINSIC
low complexity region 139 150 N/A INTRINSIC
low complexity region 156 178 N/A INTRINSIC
RRM 181 252 1.77e-24 SMART
Pfam:Fox-1_C 319 374 2.9e-18 PFAM
low complexity region 375 390 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111581
SMART Domains Protein: ENSMUSP00000129372
Gene: ENSMUSG00000033565

DomainStartEndE-ValueType
low complexity region 23 39 N/A INTRINSIC
low complexity region 71 82 N/A INTRINSIC
low complexity region 88 110 N/A INTRINSIC
RRM 113 184 1.77e-24 SMART
Pfam:Fox-1_C 252 350 3.7e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166610
SMART Domains Protein: ENSMUSP00000130673
Gene: ENSMUSG00000033565

DomainStartEndE-ValueType
low complexity region 23 39 N/A INTRINSIC
low complexity region 71 82 N/A INTRINSIC
low complexity region 88 110 N/A INTRINSIC
RRM 113 184 1.77e-24 SMART
Pfam:Fox-1_C 255 353 6.2e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171751
SMART Domains Protein: ENSMUSP00000130739
Gene: ENSMUSG00000033565

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
low complexity region 91 107 N/A INTRINSIC
low complexity region 139 150 N/A INTRINSIC
low complexity region 156 178 N/A INTRINSIC
RRM 181 252 1.77e-24 SMART
Pfam:Fox-1_C 324 421 7e-47 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181870
Predicted Effect probably benign
Transcript: ENSMUST00000227314
Predicted Effect probably benign
Transcript: ENSMUST00000227930
Predicted Effect probably benign
Transcript: ENSMUST00000227533
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230194
Predicted Effect probably benign
Transcript: ENSMUST00000228087
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227532
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.7%
  • 10x: 93.4%
  • 20x: 80.2%
Validation Efficiency 99% (84/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of several human genes similar to the C. elegans gene Fox-1. This gene encodes an RNA binding protein that is thought to be a key regulator of alternative exon splicing in the nervous system and other cell types. The protein binds to a conserved UGCAUG element found downstream of many alternatively spliced exons and promotes inclusion of the alternative exon in mature transcripts. The protein also interacts with the estrogen receptor 1 transcription factor and regulates estrogen receptor 1 transcriptional activity. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a conditional allele activated in the brain exhibit normal spontaneous and kainic acid-induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg8 A T 17: 84,994,094 (GRCm39) Y37F probably damaging Het
Ablim2 G A 5: 35,966,520 (GRCm39) probably benign Het
Anxa9 A G 3: 95,209,733 (GRCm39) S129P probably benign Het
Apol7c A G 15: 77,410,562 (GRCm39) I128T possibly damaging Het
Arfgef2 T G 2: 166,677,639 (GRCm39) I88S probably damaging Het
Arfip2 A G 7: 105,288,205 (GRCm39) probably benign Het
Atp5mf A T 5: 145,124,992 (GRCm39) probably benign Het
Atp7b C T 8: 22,518,188 (GRCm39) E205K possibly damaging Het
Atp8b5 T A 4: 43,369,715 (GRCm39) probably null Het
Cd22 A G 7: 30,569,389 (GRCm39) Y402H possibly damaging Het
Cd248 A G 19: 5,119,990 (GRCm39) T613A probably benign Het
Cdcp2 C T 4: 106,963,904 (GRCm39) probably benign Het
Cenpc1 A T 5: 86,194,405 (GRCm39) D120E probably benign Het
Chd3 T A 11: 69,250,656 (GRCm39) H691L probably damaging Het
Colec12 C T 18: 9,858,921 (GRCm39) P568L unknown Het
Cped1 T A 6: 22,121,038 (GRCm39) Y373N probably benign Het
Cr2 A T 1: 194,848,539 (GRCm39) V328D probably damaging Het
Ctnnd2 A T 15: 30,922,059 (GRCm39) E895V probably damaging Het
D630045J12Rik A T 6: 38,126,706 (GRCm39) probably benign Het
Dcdc2a A T 13: 25,371,655 (GRCm39) probably benign Het
Dync1h1 C A 12: 110,585,108 (GRCm39) T837K probably benign Het
Eif2ak3 C A 6: 70,858,716 (GRCm39) probably benign Het
Epb41l5 A C 1: 119,477,632 (GRCm39) V705G possibly damaging Het
Fat2 T A 11: 55,142,944 (GRCm39) M4302L probably benign Het
Flnb T C 14: 7,901,951 (GRCm38) V938A probably damaging Het
Frmd4a T C 2: 4,608,903 (GRCm39) Y928H probably damaging Het
Fyn C T 10: 39,387,978 (GRCm39) T78M probably benign Het
Gdap2 A G 3: 100,109,311 (GRCm39) T443A probably damaging Het
Gde1 A T 7: 118,294,283 (GRCm39) F63L probably benign Het
Gjc3 A G 5: 137,956,202 (GRCm39) S28P probably benign Het
Gm10250 G A 15: 5,150,473 (GRCm39) probably null Het
Hp1bp3 C T 4: 137,964,520 (GRCm39) S348F probably damaging Het
Klhl23 T C 2: 69,664,310 (GRCm39) V553A probably damaging Het
Lman2l G T 1: 36,463,945 (GRCm39) S171* probably null Het
Lrp1b T C 2: 41,401,520 (GRCm39) D378G probably damaging Het
Map3k11 T C 19: 5,740,843 (GRCm39) L190P probably damaging Het
Mki67 T A 7: 135,298,188 (GRCm39) Q2282L probably damaging Het
Mthfd2 T A 6: 83,285,990 (GRCm39) I272F probably damaging Het
Myom1 A T 17: 71,352,750 (GRCm39) D358V probably damaging Het
Nebl T C 2: 17,395,737 (GRCm39) probably benign Het
Nebl T A 2: 17,397,834 (GRCm39) Q487H possibly damaging Het
Nlrp2 T A 7: 5,325,417 (GRCm39) N14Y possibly damaging Het
Or14a258 T C 7: 86,035,514 (GRCm39) Y118C probably damaging Het
Or1j11 T A 2: 36,312,299 (GRCm39) D296E probably benign Het
Or2z8 C T 8: 72,812,244 (GRCm39) T240M probably damaging Het
Or5ak22 T A 2: 85,230,305 (GRCm39) S191C probably damaging Het
Or8k40 T C 2: 86,584,231 (GRCm39) M284V probably benign Het
Pasd1 T C X: 70,983,161 (GRCm39) C378R possibly damaging Het
Paxip1 C T 5: 27,949,183 (GRCm39) probably benign Het
Pclo A G 5: 14,729,811 (GRCm39) probably benign Het
Pld2 T G 11: 70,445,174 (GRCm39) N591K probably benign Het
Plekha7 A G 7: 115,769,939 (GRCm39) M276T probably damaging Het
Prss39 T A 1: 34,541,281 (GRCm39) probably benign Het
Prtg A G 9: 72,716,998 (GRCm39) Y113C probably damaging Het
Rab38 T A 7: 88,099,749 (GRCm39) I88N probably damaging Het
Samd5 A G 10: 9,550,683 (GRCm39) W9R probably damaging Het
Sec14l1 A T 11: 117,047,233 (GRCm39) K637I possibly damaging Het
Sh2b1 A T 7: 126,070,620 (GRCm39) D360E possibly damaging Het
Sh3bp4 A G 1: 89,073,036 (GRCm39) N628S possibly damaging Het
Sim1 A T 10: 50,784,057 (GRCm39) I104F probably damaging Het
Smcp T A 3: 92,491,827 (GRCm39) T7S unknown Het
Sp4 A G 12: 118,264,551 (GRCm39) probably benign Het
Tectb G T 19: 55,170,393 (GRCm39) K81N probably damaging Het
Thbs4 G T 13: 92,890,918 (GRCm39) H850N probably benign Het
Tiam1 T C 16: 89,694,642 (GRCm39) M272V probably benign Het
Trav13-3 T A 14: 53,967,233 (GRCm39) noncoding transcript Het
Ubap2l A T 3: 89,928,680 (GRCm39) S478T possibly damaging Het
Vmn2r85 A G 10: 130,255,054 (GRCm39) probably benign Het
Other mutations in Rbfox2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Rbfox2 APN 15 76,987,136 (GRCm39) missense probably damaging 1.00
R0026:Rbfox2 UTSW 15 76,968,357 (GRCm39) missense possibly damaging 0.66
R0446:Rbfox2 UTSW 15 76,983,455 (GRCm39) missense probably damaging 0.98
R0731:Rbfox2 UTSW 15 76,983,479 (GRCm39) missense probably benign 0.21
R3013:Rbfox2 UTSW 15 77,017,120 (GRCm39) missense probably damaging 1.00
R3715:Rbfox2 UTSW 15 76,983,451 (GRCm39) missense probably damaging 0.97
R4094:Rbfox2 UTSW 15 77,016,925 (GRCm39) missense probably damaging 0.99
R4543:Rbfox2 UTSW 15 77,190,568 (GRCm39) missense probably benign 0.01
R4799:Rbfox2 UTSW 15 76,976,018 (GRCm39) missense probably benign 0.28
R6194:Rbfox2 UTSW 15 76,968,357 (GRCm39) missense possibly damaging 0.66
R7316:Rbfox2 UTSW 15 77,016,929 (GRCm39) missense possibly damaging 0.92
R7501:Rbfox2 UTSW 15 76,989,834 (GRCm39) missense probably benign 0.36
R7687:Rbfox2 UTSW 15 77,190,694 (GRCm39) missense unknown
R8030:Rbfox2 UTSW 15 76,969,776 (GRCm39) critical splice donor site probably null
R8103:Rbfox2 UTSW 15 76,983,654 (GRCm39) missense probably damaging 1.00
R9093:Rbfox2 UTSW 15 77,190,658 (GRCm39) missense probably benign
RF027:Rbfox2 UTSW 15 77,016,973 (GRCm39) missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- ACACGCTCACAAGTCTTGATTGTCC -3'
(R):5'- TCAGTGTAGGCGCTACTGAGTCTTC -3'

Sequencing Primer
(F):5'- TGTCCAAAAAAGCCTCTGTTC -3'
(R):5'- GAGACAAAATGTCCTGATCTAGC -3'
Posted On 2013-06-12