Incidental Mutation 'R5566:Map3k5'
ID501204
Institutional Source Beutler Lab
Gene Symbol Map3k5
Ensembl Gene ENSMUSG00000071369
Gene Namemitogen-activated protein kinase kinase kinase 5
SynonymsASK, ASK1, 7420452D20Rik, Mekk5
MMRRC Submission 043123-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5566 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location19934472-20142753 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 20110719 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 893 (V893A)
Ref Sequence ENSEMBL: ENSMUSP00000112864 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095806] [ENSMUST00000120259]
Predicted Effect probably damaging
Transcript: ENSMUST00000095806
AA Change: V901A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000093485
Gene: ENSMUSG00000071369
AA Change: V901A

DomainStartEndE-ValueType
low complexity region 26 43 N/A INTRINSIC
low complexity region 44 58 N/A INTRINSIC
low complexity region 80 99 N/A INTRINSIC
Pfam:DUF4071 172 552 2.1e-162 PFAM
S_TKc 687 945 8.08e-92 SMART
low complexity region 1195 1207 N/A INTRINSIC
low complexity region 1225 1238 N/A INTRINSIC
coiled coil region 1251 1292 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120259
AA Change: V893A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112864
Gene: ENSMUSG00000071369
AA Change: V893A

DomainStartEndE-ValueType
low complexity region 26 43 N/A INTRINSIC
low complexity region 44 58 N/A INTRINSIC
low complexity region 80 99 N/A INTRINSIC
Pfam:DUF4071 172 544 1.7e-156 PFAM
S_TKc 679 937 8.08e-92 SMART
low complexity region 1187 1199 N/A INTRINSIC
low complexity region 1217 1230 N/A INTRINSIC
coiled coil region 1243 1284 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mitogen-activated protein kinase (MAPK) signaling cascades include MAPK or extracellular signal-regulated kinase (ERK), MAPK kinase (MKK or MEK), and MAPK kinase kinase (MAPKKK or MEKK). MAPKK kinase/MEKK phosphorylates and activates its downstream protein kinase, MAPK kinase/MEK, which in turn activates MAPK. The kinases of these signaling cascades are highly conserved, and homologs exist in yeast, Drosophila, and mammalian cells. MAPKKK5 contains 1,374 amino acids with all 11 kinase subdomains. Northern blot analysis shows that MAPKKK5 transcript is abundantly expressed in human heart and pancreas. The MAPKKK5 protein phosphorylates and activates MKK4 (aliases SERK1, MAPKK4) in vitro, and activates c-Jun N-terminal kinase (JNK)/stress-activated protein kinase (SAPK) during transient expression in COS and 293 cells; MAPKKK5 does not activate MAPK/ERK. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice are overtly normal, however apoptosis abnormalities are evident in cultured cells and after induced heart damage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik T C 18: 12,180,692 I26T possibly damaging Het
Abca13 T A 11: 9,294,615 Y2159* probably null Het
Abca3 A G 17: 24,383,927 T499A probably benign Het
Abcb5 T A 12: 118,935,967 T322S probably damaging Het
Adamts4 T A 1: 171,250,850 M1K probably null Het
Adamtsl4 C T 3: 95,685,455 probably null Het
Adh4 A T 3: 138,424,189 I259F probably damaging Het
Aff3 G A 1: 38,181,424 S1135F probably damaging Het
Arhgef16 T C 4: 154,285,648 D280G probably benign Het
Baiap3 T C 17: 25,251,733 E71G probably damaging Het
BC030867 T A 11: 102,255,833 S312T probably damaging Het
Calb2 A G 8: 110,152,700 I91T possibly damaging Het
Ccr5 A G 9: 124,124,660 N100S probably benign Het
Cep57 G T 9: 13,821,575 R25S probably damaging Het
Chadl A G 15: 81,695,878 L52P probably damaging Het
Clec12b T C 6: 129,385,475 T6A probably damaging Het
Cnga1 T A 5: 72,618,250 N43Y probably damaging Het
Col20a1 A T 2: 180,986,523 probably null Het
Csmd2 T C 4: 128,462,889 probably null Het
Ctps A T 4: 120,554,103 probably null Het
Cyp39a1 T A 17: 43,685,208 W224R possibly damaging Het
Defb29 A T 2: 152,538,928 Y54N probably benign Het
Dmbt1 A T 7: 131,106,273 D1241V probably damaging Het
Dnah1 A T 14: 31,274,366 I2671K probably benign Het
Dnah2 C A 11: 69,516,569 E158* probably null Het
Edar A G 10: 58,628,641 S59P possibly damaging Het
Egr2 T A 10: 67,540,766 C339* probably null Het
Eif5b G A 1: 38,045,684 V871I possibly damaging Het
Eif5b G A 1: 38,051,247 G1169E probably damaging Het
Erap1 A G 13: 74,662,412 Y290C probably damaging Het
Fastkd5 T A 2: 130,614,301 T790S possibly damaging Het
Fkrp C T 7: 16,810,924 V338M probably damaging Het
Gabra6 T C 11: 42,307,490 T378A probably benign Het
Gm4924 C A 10: 82,378,641 Q17K possibly damaging Het
Gm9847 A G 12: 14,494,999 noncoding transcript Het
Gpr108 A G 17: 57,236,919 F429S probably damaging Het
Gpr162 G A 6: 124,860,938 R250* probably null Het
Gtf2a1 A T 12: 91,567,594 D295E possibly damaging Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Herc1 T A 9: 66,465,537 M3125K possibly damaging Het
Hoxb6 T A 11: 96,300,754 Y167* probably null Het
Htt T C 5: 34,849,075 Y1443H probably damaging Het
Il21r A G 7: 125,625,298 D28G probably damaging Het
Impact T G 18: 12,974,762 V29G probably damaging Het
Itpr3 A G 17: 27,115,952 T2147A possibly damaging Het
Itsn2 T A 12: 4,626,554 L50Q probably damaging Het
Jade1 A G 3: 41,604,903 D473G possibly damaging Het
Kif26a T G 12: 112,157,354 L131R probably damaging Het
Kif2a A T 13: 106,993,924 M1K probably null Het
Lrsam1 C A 2: 32,941,858 Q368H probably damaging Het
Macf1 T C 4: 123,435,164 Q4592R probably damaging Het
Med13l G T 5: 118,728,665 V595F possibly damaging Het
Mocs1 T A 17: 49,454,183 L435Q possibly damaging Het
Mtmr4 T C 11: 87,604,530 L471P probably damaging Het
Myo7a T C 7: 98,064,816 E1616G possibly damaging Het
Nacad T A 11: 6,602,136 S352C probably damaging Het
Nfat5 T A 8: 107,369,135 M817K possibly damaging Het
Ofcc1 C A 13: 40,094,653 L668F probably damaging Het
Olfr1062 G A 2: 86,423,377 Q100* probably null Het
Olfr18 T C 9: 20,313,969 Q309R probably benign Het
Olfr527 C A 7: 140,336,067 D68E probably damaging Het
Plxnb2 T C 15: 89,164,020 T696A probably benign Het
Prkab2 T A 3: 97,662,293 F58L probably benign Het
Prpf4 G T 4: 62,415,969 L220F probably benign Het
Rad18 A T 6: 112,681,346 D199E probably benign Het
Raet1e T C 10: 22,174,405 L29P probably damaging Het
Ralgapb A C 2: 158,494,710 T1089P possibly damaging Het
Rest A G 5: 77,282,326 E864G probably benign Het
Rgsl1 T A 1: 153,793,774 I289F probably damaging Het
Rint1 T C 5: 23,810,953 Y406H probably damaging Het
Rpl31 C T 1: 39,370,027 R41C probably benign Het
Scn8a T C 15: 100,974,534 S485P probably damaging Het
Slamf1 T A 1: 171,787,970 V249E possibly damaging Het
Slc39a12 C T 2: 14,407,603 T362I possibly damaging Het
Sos1 C T 17: 80,453,890 V126I possibly damaging Het
Srcap T C 7: 127,525,303 F215S probably damaging Het
Supt4a T A 11: 87,743,287 S110T probably benign Het
Tbc1d30 T A 10: 121,302,110 T232S probably damaging Het
Tctex1d2 A G 16: 32,419,900 Y31C probably damaging Het
Tenm3 A G 8: 48,279,006 C1288R probably damaging Het
Tespa1 T A 10: 130,355,487 L100* probably null Het
Tgm1 C A 14: 55,712,436 R105L probably damaging Het
Tgoln1 G A 6: 72,616,035 T154I possibly damaging Het
Trp53i13 G A 11: 77,508,726 T259I probably damaging Het
Tubgcp4 T A 2: 121,184,770 F320I possibly damaging Het
Vmn1r21 A C 6: 57,844,094 Y122D probably benign Het
Vmn1r75 T A 7: 11,880,480 D46E probably damaging Het
Vmn2r120 A T 17: 57,545,290 L9M possibly damaging Het
Vmn2r59 A G 7: 42,046,823 I165T possibly damaging Het
Vmn2r76 A T 7: 86,226,078 Y564N probably damaging Het
Wee1 G T 7: 110,126,050 E300* probably null Het
Xdh T C 17: 73,893,622 D1168G probably damaging Het
Zcchc6 A T 13: 59,788,629 C817* probably null Het
Zfp54 A G 17: 21,433,444 T67A probably damaging Het
Zfp941 G T 7: 140,812,766 H227N probably benign Het
Zpr1 T A 9: 46,281,075 V399D possibly damaging Het
Zzz3 A G 3: 152,455,824 E285G probably damaging Het
Other mutations in Map3k5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00569:Map3k5 APN 10 19935044 missense possibly damaging 0.73
IGL00978:Map3k5 APN 10 20141567 missense probably damaging 1.00
IGL01470:Map3k5 APN 10 20118187 missense possibly damaging 0.89
IGL01992:Map3k5 APN 10 20029133 nonsense probably null
IGL02479:Map3k5 APN 10 20056484 missense probably damaging 1.00
IGL02728:Map3k5 APN 10 20118292 missense possibly damaging 0.71
IGL02812:Map3k5 APN 10 20025036 missense probably damaging 1.00
IGL03104:Map3k5 APN 10 20132055 missense probably benign
P0033:Map3k5 UTSW 10 20132213 splice site probably benign
PIT4434001:Map3k5 UTSW 10 20026257 missense probably damaging 0.98
R0284:Map3k5 UTSW 10 20000613 missense probably damaging 0.99
R1103:Map3k5 UTSW 10 20023676 missense probably benign 0.00
R1172:Map3k5 UTSW 10 20056648 intron probably benign
R1250:Map3k5 UTSW 10 20110775 missense possibly damaging 0.73
R1493:Map3k5 UTSW 10 20029113 missense probably damaging 1.00
R1634:Map3k5 UTSW 10 20136911 missense possibly damaging 0.64
R1693:Map3k5 UTSW 10 20104242 missense probably damaging 1.00
R1713:Map3k5 UTSW 10 20110847 missense possibly damaging 0.79
R1832:Map3k5 UTSW 10 20099560 missense probably damaging 1.00
R1844:Map3k5 UTSW 10 20104163 missense probably benign 0.33
R1869:Map3k5 UTSW 10 20132109 nonsense probably null
R2156:Map3k5 UTSW 10 20024937 missense probably damaging 1.00
R2214:Map3k5 UTSW 10 20026289 critical splice donor site probably null
R2221:Map3k5 UTSW 10 20067920 missense possibly damaging 0.96
R2223:Map3k5 UTSW 10 20067920 missense possibly damaging 0.96
R2249:Map3k5 UTSW 10 20127697 missense probably damaging 0.99
R2418:Map3k5 UTSW 10 20110857 missense probably benign 0.02
R2513:Map3k5 UTSW 10 20094455 missense possibly damaging 0.92
R3014:Map3k5 UTSW 10 20094429 missense probably damaging 1.00
R3770:Map3k5 UTSW 10 20025019 missense probably damaging 0.99
R3814:Map3k5 UTSW 10 20026190 missense probably damaging 0.99
R3814:Map3k5 UTSW 10 20140680 missense probably damaging 0.99
R4706:Map3k5 UTSW 10 20058938 missense probably damaging 1.00
R4749:Map3k5 UTSW 10 20132052 missense probably benign 0.42
R4903:Map3k5 UTSW 10 20118489 missense probably null 1.00
R4958:Map3k5 UTSW 10 20023789 missense possibly damaging 0.79
R5065:Map3k5 UTSW 10 20082467 missense probably damaging 1.00
R5210:Map3k5 UTSW 10 20024901 missense possibly damaging 0.82
R5245:Map3k5 UTSW 10 20140691 missense probably benign 0.00
R5304:Map3k5 UTSW 10 20108238 missense probably benign 0.13
R5428:Map3k5 UTSW 10 20023653 missense possibly damaging 0.93
R5914:Map3k5 UTSW 10 20104255 missense probably benign 0.24
R6155:Map3k5 UTSW 10 20118441 missense probably benign 0.01
R6161:Map3k5 UTSW 10 20000575 missense probably damaging 0.98
R6191:Map3k5 UTSW 10 20023669 missense probably damaging 0.99
R6251:Map3k5 UTSW 10 20138260 splice site probably null
R6800:Map3k5 UTSW 10 20141580 makesense probably null
R7304:Map3k5 UTSW 10 20099555 missense probably damaging 1.00
R7722:Map3k5 UTSW 10 20132145 missense probably benign 0.04
R8058:Map3k5 UTSW 10 20132114 missense probably damaging 0.99
RF024:Map3k5 UTSW 10 20100172 missense probably damaging 1.00
X0017:Map3k5 UTSW 10 20118434 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GCAGAAGGCACATCTCAGAC -3'
(R):5'- GCTTAAGATTCAGAAACCGACC -3'

Sequencing Primer
(F):5'- ACCACCTGGAGAAACGGCTG -3'
(R):5'- CAACATACCTGAAAGTTTGGGTTGTG -3'
Posted On2017-12-01