Incidental Mutation 'R5601:Prdm4'
ID501208
Institutional Source Beutler Lab
Gene Symbol Prdm4
Ensembl Gene ENSMUSG00000035529
Gene NamePR domain containing 4
Synonyms2810470D21Rik, SC-1, 1700031E19Rik
MMRRC Submission 043153-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5601 (G1)
Quality Score217
Status Not validated
Chromosome10
Chromosomal Location85891966-85917142 bp(-) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) TCTCCTCCT to TCTCCT at 85893123 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151931 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001836] [ENSMUST00000037646] [ENSMUST00000219370] [ENSMUST00000220032]
Predicted Effect probably benign
Transcript: ENSMUST00000001836
SMART Domains Protein: ENSMUSP00000001836
Gene: ENSMUSG00000001785

DomainStartEndE-ValueType
low complexity region 45 61 N/A INTRINSIC
Blast:WD40 168 220 4e-27 BLAST
WD40 244 284 4.51e-7 SMART
WD40 287 327 3.37e-6 SMART
WD40 331 370 4.42e1 SMART
WD40 373 413 6.38e-7 SMART
Blast:WD40 418 458 3e-23 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000037646
SMART Domains Protein: ENSMUSP00000041942
Gene: ENSMUSG00000035529

DomainStartEndE-ValueType
low complexity region 14 28 N/A INTRINSIC
low complexity region 33 44 N/A INTRINSIC
low complexity region 51 69 N/A INTRINSIC
low complexity region 339 353 N/A INTRINSIC
PDB:3DB5|B 386 543 2e-98 PDB
Blast:SET 408 538 5e-82 BLAST
ZnF_C2H2 548 569 7.77e1 SMART
low complexity region 575 588 N/A INTRINSIC
ZnF_C2H2 593 615 3.78e-1 SMART
ZnF_C2H2 621 643 2.27e-4 SMART
ZnF_C2H2 649 671 8.02e-5 SMART
ZnF_C2H2 677 699 3.63e-3 SMART
ZnF_C2H2 705 727 3.11e-2 SMART
ZnF_C2H2 733 753 1.81e1 SMART
low complexity region 759 780 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218743
Predicted Effect probably benign
Transcript: ENSMUST00000219370
Predicted Effect probably null
Transcript: ENSMUST00000220032
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the PR/SET family of zinc finger proteins. This protein has been shown to bind DNA in a sequence-specific manner and has been implicated in neural stem cell proliferation and differentiation. Pseudogenes have been identified on chromosomes 14 and X. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
PHENOTYPE: Mice homozygous for alleles lacking the zinc finger domain or PR/SET domain exhibit no abnormal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot12 G A 13: 91,782,910 V426I probably benign Het
Asmt T C X: 170,676,392 V212A probably damaging Het
Atn1 A G 6: 124,743,228 probably null Het
Auts2 G T 5: 131,476,823 probably benign Het
AW551984 C T 9: 39,591,267 V672M possibly damaging Het
Ccdc13 G A 9: 121,800,572 Q114* probably null Het
Ces2e A T 8: 104,929,494 I146F probably benign Het
Cfap44 A G 16: 44,460,186 K1443E probably damaging Het
Cma2 T A 14: 55,973,789 H179Q possibly damaging Het
Cpsf2 G T 12: 101,985,355 probably null Het
Cwh43 A G 5: 73,417,940 probably null Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Dram1 A G 10: 88,324,767 S231P probably damaging Het
Fbxw7 A G 3: 84,976,208 D482G probably damaging Het
Fstl1 T C 16: 37,826,799 I177T probably benign Het
Fut9 T C 4: 25,620,299 T172A probably benign Het
Gm10436 T C 12: 88,176,047 D267G probably damaging Het
Gm5134 G A 10: 75,985,952 V207M probably damaging Het
Hccs G A X: 169,313,601 R203C probably damaging Het
Hmgxb3 A T 18: 61,137,622 F877I probably damaging Het
Ide A G 19: 37,314,980 V272A unknown Het
Impact C T 18: 12,976,007 T65I probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Muc3 A G 5: 137,138,015 S309P probably damaging Het
Myf6 A C 10: 107,494,614 S31A probably damaging Het
Olfr733 C A 14: 50,298,861 W149C probably damaging Het
Olfr881 C G 9: 37,992,714 T74R possibly damaging Het
P4hb T A 11: 120,571,615 E88D possibly damaging Het
Pcdhb9 T C 18: 37,402,206 C418R probably damaging Het
Prss58 A T 6: 40,897,849 N19K possibly damaging Het
Ptprq C T 10: 107,608,430 A1438T probably benign Het
Rfx4 A T 10: 84,798,578 T61S probably damaging Het
Sclt1 T A 3: 41,730,919 N35Y probably benign Het
Sec24b CTG CTGGTG 3: 130,040,834 probably benign Het
Serpinb12 T C 1: 106,953,697 I188T probably damaging Het
Slc27a4 A T 2: 29,805,660 Y69F probably benign Het
Slc3a1 T C 17: 85,032,891 V247A probably benign Het
Slc4a2 C T 5: 24,438,774 T854I probably benign Het
Stat5b G A 11: 100,783,175 T761M probably damaging Het
Stkld1 T C 2: 26,952,705 L563P probably damaging Het
Tbc1d23 C A 16: 57,198,309 C283F probably benign Het
Tcaf3 T C 6: 42,587,528 N900S possibly damaging Het
Tkfc T C 19: 10,594,563 T370A probably benign Het
Tpr T C 1: 150,435,853 V1868A possibly damaging Het
Triobp T A 15: 78,973,633 W1145R probably damaging Het
Uhrf1bp1 C A 17: 27,884,494 A392D probably damaging Het
Vmn2r82 T G 10: 79,396,191 L675V probably damaging Het
Zfp423 T C 8: 87,782,009 E444G probably damaging Het
Other mutations in Prdm4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01864:Prdm4 APN 10 85893236 missense probably benign 0.08
IGL02514:Prdm4 APN 10 85907917 missense probably damaging 0.99
IGL02576:Prdm4 APN 10 85900937 missense possibly damaging 0.86
IGL02674:Prdm4 APN 10 85893399 missense probably damaging 0.99
IGL03002:Prdm4 APN 10 85893152 missense probably benign 0.08
IGL03153:Prdm4 APN 10 85907996 missense probably benign
IGL03278:Prdm4 APN 10 85907758 missense probably damaging 0.99
IGL03338:Prdm4 APN 10 85907821 missense possibly damaging 0.90
R0020:Prdm4 UTSW 10 85907623 missense probably benign
R0133:Prdm4 UTSW 10 85910221 critical splice donor site probably null
R0366:Prdm4 UTSW 10 85908004 missense probably damaging 1.00
R0633:Prdm4 UTSW 10 85907903 missense probably damaging 1.00
R1132:Prdm4 UTSW 10 85899281 missense probably damaging 1.00
R1460:Prdm4 UTSW 10 85907822 missense probably benign 0.28
R1477:Prdm4 UTSW 10 85904265 missense probably benign 0.00
R1680:Prdm4 UTSW 10 85899223 missense possibly damaging 0.96
R1772:Prdm4 UTSW 10 85893392 missense probably damaging 0.99
R1983:Prdm4 UTSW 10 85907953 missense probably damaging 1.00
R2136:Prdm4 UTSW 10 85893351 nonsense probably null
R3426:Prdm4 UTSW 10 85910289 missense probably damaging 1.00
R3723:Prdm4 UTSW 10 85899281 missense probably damaging 1.00
R4490:Prdm4 UTSW 10 85900899 missense probably damaging 1.00
R4750:Prdm4 UTSW 10 85899221 missense probably damaging 1.00
R5561:Prdm4 UTSW 10 85893123 makesense probably null
R5602:Prdm4 UTSW 10 85893123 makesense probably null
R5604:Prdm4 UTSW 10 85893123 makesense probably null
R5972:Prdm4 UTSW 10 85907501 missense probably damaging 1.00
R6272:Prdm4 UTSW 10 85907830 missense possibly damaging 0.82
R6300:Prdm4 UTSW 10 85910221 critical splice donor site probably null
R6457:Prdm4 UTSW 10 85908032 missense probably damaging 1.00
R6605:Prdm4 UTSW 10 85904138 missense probably benign 0.00
R6642:Prdm4 UTSW 10 85907818 missense probably benign 0.00
R7663:Prdm4 UTSW 10 85899281 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGGCACTTTGACTCAAGC -3'
(R):5'- CCTGAAGACCTGCAAAGAGC -3'

Sequencing Primer
(F):5'- CAGATAGTAAAAGTTGGCCCTCTC -3'
(R):5'- GACCTGCAAAGAGCCCAGC -3'
Posted On2017-12-01