Incidental Mutation 'R5602:Ehbp1l1'
ID501217
Institutional Source Beutler Lab
Gene Symbol Ehbp1l1
Ensembl Gene ENSMUSG00000024937
Gene NameEH domain binding protein 1-like 1
Synonyms
MMRRC Submission 043154-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5602 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location5707376-5726317 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 5708670 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1648 (E1648G)
Ref Sequence ENSEMBL: ENSMUSP00000037656 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049295] [ENSMUST00000052448] [ENSMUST00000075606]
Predicted Effect possibly damaging
Transcript: ENSMUST00000049295
AA Change: E1648G

PolyPhen 2 Score 0.847 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000037656
Gene: ENSMUSG00000024937
AA Change: E1648G

DomainStartEndE-ValueType
Pfam:NT-C2 12 164 3.2e-24 PFAM
low complexity region 245 256 N/A INTRINSIC
low complexity region 276 291 N/A INTRINSIC
internal_repeat_1 442 821 1.71e-12 PROSPERO
internal_repeat_1 833 1197 1.71e-12 PROSPERO
CH 1212 1310 3.55e-16 SMART
low complexity region 1316 1331 N/A INTRINSIC
low complexity region 1426 1449 N/A INTRINSIC
low complexity region 1471 1484 N/A INTRINSIC
low complexity region 1493 1547 N/A INTRINSIC
DUF3585 1552 1696 6.7e-59 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000052448
SMART Domains Protein: ENSMUSP00000051278
Gene: ENSMUSG00000024936

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Ion_trans_2 67 145 3.2e-14 PFAM
Pfam:Ion_trans_2 175 261 8.8e-12 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000075606
AA Change: E704G
SMART Domains Protein: ENSMUSP00000126740
Gene: ENSMUSG00000024937
AA Change: E704G

DomainStartEndE-ValueType
Pfam:NT-C2 12 164 3.9e-25 PFAM
CH 268 366 3.55e-16 SMART
low complexity region 372 387 N/A INTRINSIC
low complexity region 482 505 N/A INTRINSIC
low complexity region 527 540 N/A INTRINSIC
low complexity region 549 603 N/A INTRINSIC
DUF3585 608 752 6.7e-59 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous knockout leads to a reduction in the length and density of small intestinal microvilli, severe anemia, and neonatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik G A 9: 92,352,668 C152Y possibly damaging Het
4921509C19Rik G A 2: 151,473,539 S73F possibly damaging Het
4932414N04Rik A T 2: 68,748,368 *753L probably null Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Adam19 T C 11: 46,136,315 S592P probably benign Het
Adamtsl3 A G 7: 82,557,239 K843R possibly damaging Het
Ap2a2 A T 7: 141,604,942 T213S probably benign Het
Asb5 A G 8: 54,585,939 E280G probably benign Het
Becn1 T C 11: 101,288,952 D403G probably damaging Het
Ccr7 G T 11: 99,145,489 N202K probably benign Het
Cd36 T C 5: 17,814,792 T104A possibly damaging Het
Cnot4 C T 6: 35,051,529 W384* probably null Het
Col15a1 G A 4: 47,312,087 V1301M probably damaging Het
Dock2 C A 11: 34,254,391 A1384S probably benign Het
Fbn1 G T 2: 125,321,741 A2065E possibly damaging Het
Fras1 A G 5: 96,737,021 Y2586C probably damaging Het
Galm T A 17: 80,150,139 Y28* probably null Het
Ggt7 A G 2: 155,490,999 V648A possibly damaging Het
Gm17067 T A 7: 42,708,415 D221V probably damaging Het
Gpr3 T C 4: 133,210,494 N289S probably damaging Het
Ighv11-2 G A 12: 114,048,479 L39F probably damaging Het
Ighv11-2 A G 12: 114,048,657 probably benign Het
Ipo9 G A 1: 135,402,245 L486F probably damaging Het
Jak2 T A 19: 29,298,339 N726K probably benign Het
Map4 T C 9: 110,052,700 S211P possibly damaging Het
Mlh1 A T 9: 111,252,878 L259Q probably damaging Het
Naa25 A G 5: 121,420,495 E300G probably benign Het
Olfr954 A T 9: 39,462,030 M200L probably benign Het
Olfr969 T A 9: 39,796,194 V273E possibly damaging Het
Parva G A 7: 112,567,765 V182I probably benign Het
Pcdhgb4 T C 18: 37,721,644 I364T probably damaging Het
Pdik1l A G 4: 134,284,269 S164P probably damaging Het
Pfas A T 11: 68,991,045 I938N probably benign Het
Prdm4 TCTCCTCCT TCTCCT 10: 85,893,123 probably null Het
Prob1 C T 18: 35,654,026 V392M possibly damaging Het
Rasgrf1 T C 9: 89,911,571 S134P possibly damaging Het
Rorb T A 19: 18,977,937 Y20F probably damaging Het
Rsph9 G T 17: 46,134,983 D220E probably damaging Het
Safb2 C A 17: 56,575,630 K334N possibly damaging Het
Sall3 T C 18: 80,972,812 T634A probably benign Het
Scaf1 A G 7: 45,007,583 probably benign Het
Slco1a5 T A 6: 142,275,529 probably benign Het
Spata21 C T 4: 141,096,899 R158C probably benign Het
Srrm2 G A 17: 23,819,337 probably benign Het
Stk38l C A 6: 146,758,500 T10N probably benign Het
Supv3l1 G A 10: 62,430,592 P602S possibly damaging Het
Timm44 C T 8: 4,266,769 probably null Het
Tll2 T A 19: 41,104,981 R465S possibly damaging Het
Tmem104 G A 11: 115,205,124 A164T probably damaging Het
Tmem151b A G 17: 45,545,600 S305P probably damaging Het
Utrn T C 10: 12,750,095 D114G probably damaging Het
Vmn2r109 A T 17: 20,540,671 M808K possibly damaging Het
Washc2 T A 6: 116,248,095 D801E possibly damaging Het
Xkr4 T C 1: 3,216,528 I480V probably benign Het
Zfp507 G T 7: 35,776,238 S58* probably null Het
Zfp768 T A 7: 127,344,632 D108V possibly damaging Het
Other mutations in Ehbp1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00933:Ehbp1l1 APN 19 5717933 missense probably benign 0.33
IGL01061:Ehbp1l1 APN 19 5717888 missense probably benign
IGL01372:Ehbp1l1 APN 19 5715789 splice site probably benign
IGL01790:Ehbp1l1 APN 19 5722984 missense probably damaging 0.99
IGL01936:Ehbp1l1 APN 19 5718249 nonsense probably null
IGL02194:Ehbp1l1 APN 19 5718857 missense probably benign
IGL02347:Ehbp1l1 APN 19 5719572 missense possibly damaging 0.72
IGL02372:Ehbp1l1 APN 19 5710834 missense possibly damaging 0.53
IGL02681:Ehbp1l1 APN 19 5720825 missense probably damaging 0.98
IGL02824:Ehbp1l1 APN 19 5719298 missense probably benign
IGL03070:Ehbp1l1 APN 19 5715953 missense probably benign 0.33
IGL03146:Ehbp1l1 APN 19 5720033 missense probably benign 0.00
PIT4802001:Ehbp1l1 UTSW 19 5719575 missense possibly damaging 0.93
R0309:Ehbp1l1 UTSW 19 5720570 missense possibly damaging 0.72
R0787:Ehbp1l1 UTSW 19 5722668 missense possibly damaging 0.95
R1156:Ehbp1l1 UTSW 19 5708336 unclassified probably benign
R1337:Ehbp1l1 UTSW 19 5718230 missense probably benign 0.00
R1474:Ehbp1l1 UTSW 19 5719084 missense possibly damaging 0.86
R1501:Ehbp1l1 UTSW 19 5716424 missense probably damaging 0.98
R1582:Ehbp1l1 UTSW 19 5721967 missense possibly damaging 0.83
R1766:Ehbp1l1 UTSW 19 5716406 missense probably damaging 0.98
R1838:Ehbp1l1 UTSW 19 5717691 missense probably benign 0.39
R1842:Ehbp1l1 UTSW 19 5725930 missense probably damaging 0.99
R1863:Ehbp1l1 UTSW 19 5717854 missense probably benign 0.01
R1955:Ehbp1l1 UTSW 19 5710669 missense possibly damaging 0.51
R2010:Ehbp1l1 UTSW 19 5719283 missense probably benign
R2098:Ehbp1l1 UTSW 19 5708658 missense possibly damaging 0.93
R2099:Ehbp1l1 UTSW 19 5718401 missense possibly damaging 0.72
R2852:Ehbp1l1 UTSW 19 5716487 missense probably damaging 0.99
R3113:Ehbp1l1 UTSW 19 5718980 missense probably benign 0.38
R3799:Ehbp1l1 UTSW 19 5719115 missense probably benign 0.33
R3891:Ehbp1l1 UTSW 19 5718312 missense possibly damaging 0.73
R3964:Ehbp1l1 UTSW 19 5710573 critical splice donor site probably null
R3966:Ehbp1l1 UTSW 19 5710573 critical splice donor site probably null
R4335:Ehbp1l1 UTSW 19 5708769 missense probably damaging 0.98
R4434:Ehbp1l1 UTSW 19 5716248 missense possibly damaging 0.93
R4457:Ehbp1l1 UTSW 19 5716293 missense possibly damaging 0.83
R4597:Ehbp1l1 UTSW 19 5717927 missense possibly damaging 0.72
R4726:Ehbp1l1 UTSW 19 5719176 missense possibly damaging 0.70
R4761:Ehbp1l1 UTSW 19 5719847 missense possibly damaging 0.93
R4771:Ehbp1l1 UTSW 19 5725968 missense probably damaging 1.00
R5402:Ehbp1l1 UTSW 19 5716320 missense possibly damaging 0.91
R5436:Ehbp1l1 UTSW 19 5716248 missense possibly damaging 0.93
R5893:Ehbp1l1 UTSW 19 5718431 missense probably benign
R6329:Ehbp1l1 UTSW 19 5718767 missense possibly damaging 0.53
R6416:Ehbp1l1 UTSW 19 5718757 missense probably benign 0.01
R7106:Ehbp1l1 UTSW 19 5718737 missense probably benign 0.33
R7262:Ehbp1l1 UTSW 19 5718446 nonsense probably null
R7304:Ehbp1l1 UTSW 19 5716382 missense probably damaging 1.00
R7317:Ehbp1l1 UTSW 19 5720702 missense probably benign 0.44
R7404:Ehbp1l1 UTSW 19 5720844 missense possibly damaging 0.72
R7447:Ehbp1l1 UTSW 19 5719428 missense possibly damaging 0.53
R7862:Ehbp1l1 UTSW 19 5720823 missense probably benign
R7881:Ehbp1l1 UTSW 19 5719398 missense probably benign
R7910:Ehbp1l1 UTSW 19 5716424 missense probably benign 0.28
R8239:Ehbp1l1 UTSW 19 5720061 missense possibly damaging 0.53
R8309:Ehbp1l1 UTSW 19 5717075 missense probably damaging 1.00
R8324:Ehbp1l1 UTSW 19 5719998 missense possibly damaging 0.86
R8724:Ehbp1l1 UTSW 19 5715858 missense possibly damaging 0.73
RF053:Ehbp1l1 UTSW 19 5716002 small deletion probably benign
Z1088:Ehbp1l1 UTSW 19 5716287 missense possibly damaging 0.77
Z1176:Ehbp1l1 UTSW 19 5717889 missense probably benign
Z1177:Ehbp1l1 UTSW 19 5718762 missense probably damaging 0.99
Z1177:Ehbp1l1 UTSW 19 5719101 missense probably benign 0.07
Z1177:Ehbp1l1 UTSW 19 5719102 missense probably benign 0.01
Z1177:Ehbp1l1 UTSW 19 5719434 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AGTTAGTCTCAAAGTTGGCCCTAC -3'
(R):5'- TTCTCTGACAGCATCGAGGAG -3'

Sequencing Primer
(F):5'- AAGTTGGCCCTACTTGCAAG -3'
(R):5'- CATCGAGGAGCAGGACTTG -3'
Posted On2017-12-01