Mutagenetix > Incidental Mutation

Incidental Mutation 'R5616:Arhgef5'

501222

Institutional Source

Beutler Lab

Gene Symbol

Arhgef5

Ensembl Gene

ENSMUSG00000033542

Gene Name

Rho guanine nucleotide exchange factor (GEF) 5

Synonyms

2210412D05Rik

MMRRC Submission

043159-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5616 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

43265582-43289320 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 43275940 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 1037 (D1037G)

Ref Sequence

ENSEMBL: ENSMUSP00000031750 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031750]

AlphaFold

E9Q7D5

Predicted Effect

probably benign
Transcript: ENSMUST00000031750
AA Change: D1037G

PolyPhen 2 Score 0.199 (Sensitivity: 0.92; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000031750
Gene: ENSMUSG00000033542
AA Change: D1037G

Domain	Start	End	E-Value	Type
Pfam:ARHGEF5_35	1	477	3.1e-220	PFAM
low complexity region	509	531	N/A	INTRINSIC
low complexity region	812	825	N/A	INTRINSIC
low complexity region	827	851	N/A	INTRINSIC
RhoGEF	1162	1341	2.97e-57	SMART
PH	1375	1488	1.11e-6	SMART
SH3	1497	1554	6.39e-15	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000182190

Predicted Effect

unknown
Transcript: ENSMUST00000182924
AA Change: D305G

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183094

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183227

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000203387

Coding Region Coverage

1x: 99.4%
3x: 98.7%
10x: 97.4%
20x: 95.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes initiated by extracellular stimuli that work through G protein coupled receptors. The encoded protein may form a complex with G proteins and stimulate Rho-dependent signals. This protein may be involved in the control of cytoskeletal organization. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased Th2 response in an ovalbumin-induced asthma model. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcd3	A	T	3: 121,772,360	D443E	probably benign	Het
B3glct	T	A	5: 149,729,934	L148*	probably null	Het
Cacna1e	G	A	1: 154,442,194	P1481S	probably damaging	Het
Cacna1h	C	A	17: 25,377,667	R117L	probably damaging	Het
Cct6b	A	T	11: 82,741,349	V271E	probably damaging	Het
Cenpf	A	G	1: 189,657,286	S1450P	probably damaging	Het
Cul1	G	A	6: 47,523,788	R707H	probably damaging	Het
Dcakd	A	G	11: 102,995,005	L191P	possibly damaging	Het
Dhx32	T	C	7: 133,721,228	*612W	probably null	Het
Disp1	T	A	1: 183,088,349	T836S	probably benign	Het
Dppa4	T	A	16: 48,291,030	V126D	probably damaging	Het
Fam98b	A	G	2: 117,267,786	T246A	possibly damaging	Het
Fkbp4	A	T	6: 128,433,554	V273E	probably damaging	Het
Gm7102	C	T	19: 61,175,926	G24R	unknown	Het
Gpr31b	A	G	17: 13,051,944	Y113H	probably damaging	Het
Gpr33	T	C	12: 52,023,594	I221V	probably damaging	Het
Klhl1	A	G	14: 96,518,293	F9L	probably benign	Het
Larp4b	T	A	13: 9,158,659	N449K	probably damaging	Het
Loxhd1	T	C	18: 77,404,951	S1363P	probably damaging	Het
Lrrc8a	T	C	2: 30,255,354	V60A	probably benign	Het
Matn3	A	G	12: 8,948,195	H51R	probably benign	Het
Mtrf1	T	C	14: 79,401,445	C6R	possibly damaging	Het
Myh6	T	C	14: 54,956,581	S784G	probably benign	Het
Nfkb2	G	T	19: 46,307,567	E170D	probably benign	Het
Nipal3	T	C	4: 135,452,404	Y401C	probably benign	Het
Pcdhb20	A	G	18: 37,504,532	E37G	probably damaging	Het
Pelp1	G	A	11: 70,394,862	P727S	possibly damaging	Het
Prkca	T	C	11: 107,978,343	D472G	possibly damaging	Het
Ptprg	A	G	14: 12,122,120	H328R	probably benign	Het
Rtl1	C	T	12: 109,592,739	E889K	unknown	Het
Rubcn	T	C	16: 32,826,923	D715G	possibly damaging	Het
Snurf	C	T	7: 59,999,385	E15K	possibly damaging	Het
Sptbn5	G	A	2: 120,046,484		probably benign	Het
Srp72	T	G	5: 76,987,934	L237R	probably damaging	Het
Syne3	T	C	12: 104,955,678	E406G	probably damaging	Het
Tgm2	A	G	2: 158,128,720	S340P	probably damaging	Het
Trim41	GCCTAGGCGCCCA	G	11: 48,807,365		probably benign	Het
Tsc22d1	T	C	14: 76,416,217		probably benign	Het
Tsc22d2	G	T	3: 58,417,162		probably benign	Het
Vmn1r42	T	C	6: 89,845,102	I162V	possibly damaging	Het
Vmn2r59	A	G	7: 42,058,767		probably null	Het
Wnt3	T	C	11: 103,812,770		probably null	Het

Other mutations in Arhgef5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00341:Arhgef5	APN	6	43280269	nonsense	probably null
IGL01341:Arhgef5	APN	6	43283991	missense	probably damaging	1.00
IGL01576:Arhgef5	APN	6	43274028	missense	probably benign	0.38
IGL01761:Arhgef5	APN	6	43274604	missense	probably benign	0.00
IGL02104:Arhgef5	APN	6	43272411	missense	probably damaging	0.99
IGL02208:Arhgef5	APN	6	43275130	missense	probably benign	0.11
IGL02487:Arhgef5	APN	6	43283982	missense	probably damaging	1.00
IGL02650:Arhgef5	APN	6	43272935	nonsense	probably null
IGL03292:Arhgef5	APN	6	43280246	missense	probably damaging	1.00
IGL03334:Arhgef5	APN	6	43274000	missense	possibly damaging	0.47
IGL03341:Arhgef5	APN	6	43280651	missense	probably damaging	0.99
R0047:Arhgef5	UTSW	6	43265621	splice site	probably null
R0206:Arhgef5	UTSW	6	43273341	missense	probably damaging	1.00
R0208:Arhgef5	UTSW	6	43273341	missense	probably damaging	1.00
R0698:Arhgef5	UTSW	6	43273341	missense	probably damaging	1.00
R1145:Arhgef5	UTSW	6	43273088	missense	possibly damaging	0.92
R1145:Arhgef5	UTSW	6	43273088	missense	possibly damaging	0.92
R1168:Arhgef5	UTSW	6	43273396	missense	probably benign	0.00
R1355:Arhgef5	UTSW	6	43283912	missense	probably damaging	1.00
R1370:Arhgef5	UTSW	6	43283912	missense	probably damaging	1.00
R1481:Arhgef5	UTSW	6	43274634	missense	probably damaging	0.99
R1529:Arhgef5	UTSW	6	43279515	missense	probably damaging	0.96
R1532:Arhgef5	UTSW	6	43273403	missense	probably benign
R1663:Arhgef5	UTSW	6	43276965	missense	probably damaging	1.00
R1742:Arhgef5	UTSW	6	43280199	missense	probably damaging	1.00
R1852:Arhgef5	UTSW	6	43275185	missense	probably benign	0.00
R1869:Arhgef5	UTSW	6	43288682	missense	probably damaging	1.00
R1880:Arhgef5	UTSW	6	43273088	missense	possibly damaging	0.92
R2146:Arhgef5	UTSW	6	43283318	missense	probably damaging	1.00
R2169:Arhgef5	UTSW	6	43274420	missense	probably benign	0.11
R3412:Arhgef5	UTSW	6	43273790	missense	probably benign
R4205:Arhgef5	UTSW	6	43273832	missense	possibly damaging	0.76
R4226:Arhgef5	UTSW	6	43279498	missense	probably damaging	1.00
R4227:Arhgef5	UTSW	6	43279498	missense	probably damaging	1.00
R4304:Arhgef5	UTSW	6	43279498	missense	probably damaging	1.00
R4308:Arhgef5	UTSW	6	43279498	missense	probably damaging	1.00
R4457:Arhgef5	UTSW	6	43274093	missense	probably damaging	1.00
R4469:Arhgef5	UTSW	6	43275099	missense	probably benign
R4636:Arhgef5	UTSW	6	43274942	missense	probably benign	0.11
R4791:Arhgef5	UTSW	6	43283183	missense	probably damaging	1.00
R4818:Arhgef5	UTSW	6	43273550	missense	probably benign	0.00
R4910:Arhgef5	UTSW	6	43272828	missense	probably benign	0.01
R4911:Arhgef5	UTSW	6	43272828	missense	probably benign	0.01
R5127:Arhgef5	UTSW	6	43273214	missense	probably damaging	0.99
R5209:Arhgef5	UTSW	6	43273700	missense	probably benign	0.01
R5245:Arhgef5	UTSW	6	43265680	start gained	probably benign
R5251:Arhgef5	UTSW	6	43272881	missense	possibly damaging	0.76
R5513:Arhgef5	UTSW	6	43272339	missense	probably damaging	0.96
R5613:Arhgef5	UTSW	6	43274063	missense	probably benign	0.01
R5817:Arhgef5	UTSW	6	43275104	missense	probably benign	0.15
R6024:Arhgef5	UTSW	6	43275134	missense	probably benign	0.00
R6735:Arhgef5	UTSW	6	43275032	missense	probably benign	0.01
R6825:Arhgef5	UTSW	6	43274961	missense	probably damaging	0.99
R6831:Arhgef5	UTSW	6	43280999	missense	probably damaging	1.00
R6901:Arhgef5	UTSW	6	43273298	missense	probably benign	0.00
R6932:Arhgef5	UTSW	6	43274417	missense	possibly damaging	0.94
R6968:Arhgef5	UTSW	6	43275342	missense	probably benign	0.00
R7018:Arhgef5	UTSW	6	43288731	missense	probably damaging	1.00
R7180:Arhgef5	UTSW	6	43275208	missense	possibly damaging	0.87
R7201:Arhgef5	UTSW	6	43273232	nonsense	probably null
R7358:Arhgef5	UTSW	6	43279573	missense	probably damaging	1.00
R7359:Arhgef5	UTSW	6	43280282	missense	probably damaging	1.00
R7468:Arhgef5	UTSW	6	43280671	nonsense	probably null
R7503:Arhgef5	UTSW	6	43273999	missense	probably benign	0.15
R7699:Arhgef5	UTSW	6	43274757	missense	probably benign	0.11
R7700:Arhgef5	UTSW	6	43274757	missense	probably benign	0.11
R7737:Arhgef5	UTSW	6	43273794	missense	possibly damaging	0.84
R7847:Arhgef5	UTSW	6	43275135	nonsense	probably null
R7950:Arhgef5	UTSW	6	43273925	missense	possibly damaging	0.76
R8161:Arhgef5	UTSW	6	43283951	missense	probably damaging	1.00
R8178:Arhgef5	UTSW	6	43275185	missense	probably benign	0.00
R8203:Arhgef5	UTSW	6	43280645	missense	probably damaging	1.00
R8318:Arhgef5	UTSW	6	43275999	critical splice donor site	probably null
R8857:Arhgef5	UTSW	6	43287624	missense	probably damaging	1.00
R9499:Arhgef5	UTSW	6	43284006	missense
R9610:Arhgef5	UTSW	6	43280956	missense	probably damaging	0.99
R9611:Arhgef5	UTSW	6	43280956	missense	probably damaging	0.99
R9623:Arhgef5	UTSW	6	43274802	missense	possibly damaging	0.86
R9685:Arhgef5	UTSW	6	43273593	missense	probably benign	0.11
RF023:Arhgef5	UTSW	6	43279473	missense	probably damaging	1.00
X0028:Arhgef5	UTSW	6	43273701	missense	probably benign	0.03
X0065:Arhgef5	UTSW	6	43272408	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- CTGTCTTGCATGAAGGCTGG -3'
(R):5'- AAGCACCAGCAATTCTCGATTC -3'

Sequencing Primer
(F):5'- GGAATTTCTACCCTGACATGAGCG -3'
(R):5'- AGCAATTCTCGATTCCAGGATC -3'

Posted On

2017-12-01