Incidental Mutation 'R5657:Plod1'
ID501235
Institutional Source Beutler Lab
Gene Symbol Plod1
Ensembl Gene ENSMUSG00000019055
Gene Nameprocollagen-lysine, 2-oxoglutarate 5-dioxygenase 1
SynonymsLH1, 2410042F05Rik, lysyl hydroxylase 1
MMRRC Submission 043171-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5657 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location147909753-147936767 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 147918781 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 529 (E529G)
Ref Sequence ENSEMBL: ENSMUSP00000019199 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019199]
Predicted Effect possibly damaging
Transcript: ENSMUST00000019199
AA Change: E529G

PolyPhen 2 Score 0.457 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000019199
Gene: ENSMUSG00000019055
AA Change: E529G

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 301 313 N/A INTRINSIC
Blast:P4Hc 444 492 1e-8 BLAST
P4Hc 554 727 4.87e-26 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124041
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124292
Predicted Effect unknown
Transcript: ENSMUST00000149129
AA Change: E115G
SMART Domains Protein: ENSMUSP00000118857
Gene: ENSMUSG00000019055
AA Change: E115G

DomainStartEndE-ValueType
Blast:P4Hc 31 136 5e-33 BLAST
Blast:P4Hc 141 269 4e-47 BLAST
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Lysyl hydroxylase is a membrane-bound homodimeric protein localized to the cisternae of the endoplasmic reticulum. The enzyme (cofactors iron and ascorbate) catalyzes the hydroxylation of lysyl residues in collagen-like peptides. The resultant hydroxylysyl groups are attachment sites for carbohydrates in collagen and thus are critical for the stability of intermolecular crosslinks. Some patients with Ehlers-Danlos syndrome type VI have deficiencies in lysyl hydroxylase activity. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit hypotonia, reduced voluntary movement, abnormal aorta and skin collagen fibers, irregular vascular smooth muscle and premature death associated with thoracic cavity hemorrhage and aortic dissection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl5 A G 5: 30,894,046 Y533C probably damaging Het
Ahnak T C 19: 9,014,615 V4421A probably damaging Het
Bach1 A G 16: 87,719,285 K238R probably benign Het
Bloc1s6 T A 2: 122,738,657 V12D probably benign Het
Clca3b C A 3: 144,827,383 L629F probably benign Het
Clhc1 A G 11: 29,561,431 I292V probably benign Het
Col27a1 T C 4: 63,225,310 S412P probably damaging Het
Col6a4 A G 9: 106,072,198 I746T probably damaging Het
Cracr2a G A 6: 127,604,007 A49T probably damaging Het
Cyb561d1 A G 3: 108,200,692 I28T possibly damaging Het
Dnah11 T A 12: 117,883,617 M4264L probably damaging Het
Dnajc13 A G 9: 104,228,537 L412S probably damaging Het
Dpf3 T C 12: 83,325,011 N150S probably damaging Het
Epha2 T C 4: 141,323,494 C854R probably damaging Het
Fat2 G T 11: 55,310,681 Y522* probably null Het
Foxm1 A T 6: 128,373,388 S551C possibly damaging Het
Galnt12 T C 4: 47,104,150 V136A possibly damaging Het
Gm6647 T G 5: 13,768,821 noncoding transcript Het
Grin2b T A 6: 135,733,087 I1154F possibly damaging Het
Hmcn1 A G 1: 150,658,562 V2987A probably benign Het
Jade2 A G 11: 51,816,987 S800P probably damaging Het
Naip6 C A 13: 100,300,401 S538I probably benign Het
Olfr393 T C 11: 73,847,540 N195S probably damaging Het
Plekha6 G C 1: 133,272,307 R208P possibly damaging Het
Plppr2 T C 9: 21,947,615 C343R probably damaging Het
Prpf38a T C 4: 108,568,424 D219G probably damaging Het
Ptpra G A 2: 130,504,284 E122K probably benign Het
Rabl2 T C 15: 89,588,213 M38V probably benign Het
Reep1 A G 6: 71,761,374 M39V possibly damaging Het
Rsf1 GC GCGGCGGCGTC 7: 97,579,934 probably benign Het
Slc26a10 T C 10: 127,174,964 probably benign Het
Sun2 C A 15: 79,727,949 E510* probably null Het
Tanc1 A G 2: 59,834,707 probably null Het
Ticam1 TCACACA TCACA 17: 56,270,629 probably null Het
Tor1aip1 G T 1: 156,007,488 H205N probably damaging Het
Trpc6 C T 9: 8,609,807 T92I probably benign Het
Vmn2r100 T A 17: 19,504,916 F36I probably benign Het
Zfp787 T C 7: 6,133,054 Y66C probably damaging Het
Other mutations in Plod1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01144:Plod1 APN 4 147932754 missense probably benign 0.12
IGL02312:Plod1 APN 4 147926157 missense probably benign 0.09
IGL02588:Plod1 APN 4 147913290 nonsense probably null
IGL02712:Plod1 APN 4 147918887 missense possibly damaging 0.95
IGL02976:Plod1 APN 4 147913321 missense probably damaging 0.99
IGL03244:Plod1 APN 4 147923123 critical splice donor site probably null
R0393:Plod1 UTSW 4 147918841 missense probably null 0.35
R1216:Plod1 UTSW 4 147921127 missense probably damaging 0.98
R1897:Plod1 UTSW 4 147926200 missense probably damaging 0.97
R3776:Plod1 UTSW 4 147931277 missense possibly damaging 0.75
R3923:Plod1 UTSW 4 147915823 missense possibly damaging 0.62
R4718:Plod1 UTSW 4 147916244 intron probably benign
R4897:Plod1 UTSW 4 147920279 missense probably benign
R5173:Plod1 UTSW 4 147916301 intron probably benign
R6298:Plod1 UTSW 4 147916315 intron probably benign
R6995:Plod1 UTSW 4 147916218 intron probably benign
R7176:Plod1 UTSW 4 147913287 missense probably benign 0.00
R7632:Plod1 UTSW 4 147927024 missense probably damaging 1.00
R8059:Plod1 UTSW 4 147928484 missense probably damaging 1.00
R8167:Plod1 UTSW 4 147920201 missense probably damaging 1.00
R8804:Plod1 UTSW 4 147913321 missense probably damaging 0.99
X0013:Plod1 UTSW 4 147927042 missense possibly damaging 0.70
Y5406:Plod1 UTSW 4 147931187 missense probably damaging 1.00
Y5408:Plod1 UTSW 4 147931187 missense probably damaging 1.00
Z1176:Plod1 UTSW 4 147923200 missense probably damaging 0.99
Z1177:Plod1 UTSW 4 147931721 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TCAATTAAGTCATAGCTCCCTGC -3'
(R):5'- GCTGGGAGCACATACTGTACTC -3'

Sequencing Primer
(F):5'- GCTCCCTGCTCCACTAGGTG -3'
(R):5'- ACTCACAGGTCTTTAATCTGGTTG -3'
Posted On2017-12-01