Mutagenetix > Incidental Mutation

Incidental Mutation 'R5677:Tenm2'

501255

Institutional Source

Beutler Lab

Gene Symbol

Tenm2

Ensembl Gene

ENSMUSG00000049336

Gene Name

teneurin transmembrane protein 2

Synonyms

2610040L17Rik, 9330187F13Rik, D3Bwg1534e, Ten-m2, Odz2

MMRRC Submission

043316-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.584) question?

Stock #

R5677 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

36006656-37235964 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 36141683 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 670 (V670A)

Ref Sequence

ENSEMBL: ENSMUSP00000052014 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000057207] [ENSMUST00000102801] [ENSMUST00000163524]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000057207
AA Change: V670A

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000052014
Gene: ENSMUSG00000049336
AA Change: V670A

Domain	Start	End	E-Value	Type
Pfam:Ten_N	10	374	4.9e-177	PFAM
transmembrane domain	375	397	N/A	INTRINSIC
EGF	575	603	5.62e0	SMART
EGF_like	606	634	4.93e1	SMART
EGF	639	668	1.76e1	SMART
EGF	671	700	1.43e-1	SMART
EGF	705	735	1.2e1	SMART
EGF	738	766	9.63e0	SMART
EGF	769	797	1.25e1	SMART
EGF	800	832	1.4e0	SMART
low complexity region	1459	1475	N/A	INTRINSIC
low complexity region	2219	2230	N/A	INTRINSIC
Pfam:Tox-GHH	2681	2758	1.4e-34	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000102801
AA Change: V670A

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000099865
Gene: ENSMUSG00000049336
AA Change: V670A

Domain	Start	End	E-Value	Type
Pfam:Ten_N	9	374	2e-186	PFAM
transmembrane domain	375	397	N/A	INTRINSIC
EGF	575	603	5.62e0	SMART
EGF_like	606	634	4.93e1	SMART
EGF	639	668	1.76e1	SMART
EGF	671	700	1.43e-1	SMART
EGF	705	735	1.2e1	SMART
EGF	737	765	9.63e0	SMART
EGF	768	796	1.25e1	SMART
EGF	799	831	1.4e0	SMART
low complexity region	1458	1474	N/A	INTRINSIC
low complexity region	2218	2229	N/A	INTRINSIC
Pfam:Tox-GHH	2679	2757	2e-34	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146113

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149787

Predicted Effect

probably benign
Transcript: ENSMUST00000163524
AA Change: V670A

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000129951
Gene: ENSMUSG00000049336
AA Change: V670A

Domain	Start	End	E-Value	Type
Pfam:Ten_N	9	374	2e-186	PFAM
transmembrane domain	375	397	N/A	INTRINSIC
EGF	575	603	5.62e0	SMART
EGF_like	606	634	4.93e1	SMART
EGF	639	668	1.76e1	SMART
EGF	671	700	1.43e-1	SMART
EGF	705	735	1.2e1	SMART
EGF	737	765	9.63e0	SMART
EGF	768	796	1.25e1	SMART
EGF	799	831	1.4e0	SMART
low complexity region	1458	1474	N/A	INTRINSIC
low complexity region	2218	2229	N/A	INTRINSIC
Pfam:Tox-GHH	2679	2757	2e-34	PFAM

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.9%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a null allele show abnormalities in the laterality and mapping of ipsilateral retinal projections that lead to loss of ipsilateral drive, defects in binocular vision, and impaired performance on a visual discrimination task. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 116 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310057J18Rik	C	T	10: 28,986,229	V22I	probably benign	Het
4930430A15Rik	T	C	2: 111,211,565	T342A	probably benign	Het
4931423N10Rik	T	A	2: 23,212,718	L156Q	probably damaging	Het
Abca8a	A	T	11: 110,038,399	V1296D	possibly damaging	Het
Abca8b	C	T	11: 109,940,861	S1328N	probably damaging	Het
Adcy1	G	A	11: 7,161,914	M926I	probably damaging	Het
Aff4	G	T	11: 53,400,275	M687I	possibly damaging	Het
Agbl2	T	A	2: 90,807,978	Y636N	possibly damaging	Het
Agtr1a	A	T	13: 30,381,584	I211F	probably damaging	Het
Alkbh8	T	G	9: 3,385,147	S480A	possibly damaging	Het
Ankrd13b	A	T	11: 77,477,544	V84E	probably damaging	Het
Ap3b1	C	T	13: 94,528,196	T881I	unknown	Het
Apbb1	A	C	7: 105,559,246	D617E	probably damaging	Het
Apobec4	A	G	1: 152,757,282	R354G	probably benign	Het
BC003331	G	A	1: 150,374,837	L319F	probably damaging	Het
Brdt	T	G	5: 107,348,617	C198W	possibly damaging	Het
Cacna1b	G	T	2: 24,679,358	H851Q	possibly damaging	Het
Car2	G	T	3: 14,898,055	V217F	possibly damaging	Het
Ccdc24	A	C	4: 117,869,880		probably benign	Het
Chodl	C	A	16: 78,941,315	A57E	probably damaging	Het
Clgn	G	T	8: 83,409,538	C185F	probably damaging	Het
Cltc	G	T	11: 86,705,242	N1223K	probably damaging	Het
Cnot10	T	C	9: 114,629,093	N115S	probably damaging	Het
Col12a1	T	C	9: 79,699,321	R607G	probably damaging	Het
Cpd	A	G	11: 76,799,825	V835A	probably benign	Het
Csmd3	G	C	15: 48,622,051	L153V	probably damaging	Het
Ctr9	A	G	7: 111,044,002	H527R	probably benign	Het
Cwc22	G	A	2: 77,929,443	R87W	probably damaging	Het
D930020B18Rik	T	A	10: 121,669,201	N107K	probably benign	Het
Dgkg	C	A	16: 22,570,171	V418L	probably benign	Het
Dhx40	A	G	11: 86,800,963		probably null	Het
Diaph1	A	T	18: 37,855,951	M910K	probably damaging	Het
Diras2	T	A	13: 52,507,675	M199L	possibly damaging	Het
Dnah8	G	A	17: 30,748,568	D2585N	probably benign	Het
Dock5	T	A	14: 67,777,603	Q1302H	probably benign	Het
Dync1i2	T	C	2: 71,228,623	S90P	probably benign	Het
E2f8	A	T	7: 48,867,195	V812E	probably damaging	Het
Egfem1	C	A	3: 29,690,174	Q521K	probably damaging	Het
Fbxl18	A	T	5: 142,878,720	C699*	probably null	Het
Fgf3	C	T	7: 144,838,783	R26*	probably null	Het
Fpr-rs7	T	G	17: 20,114,103	I42L	probably benign	Het
Gm13101	A	T	4: 143,965,138	D338E	possibly damaging	Het
Gm3159	T	A	14: 4,398,582	M91K	probably damaging	Het
Gprin3	A	G	6: 59,353,892	S477P	possibly damaging	Het
Grm8	A	T	6: 27,761,204		probably null	Het
Hepacam2	A	T	6: 3,466,142	D420E	probably damaging	Het
Hmcn1	A	T	1: 150,609,778	W4358R	probably benign	Het
Ifna6	G	A	4: 88,827,719	A102T	probably benign	Het
Ighv2-2	T	C	12: 113,588,522	Q32R	probably benign	Het
Igkv1-131	T	A	6: 67,766,258	Q47L	possibly damaging	Het
Il16	T	C	7: 83,674,553	E263G	probably damaging	Het
Kansl1	A	T	11: 104,335,148	C981S	probably benign	Het
Lrp1	A	T	10: 127,574,429	F1483I	probably damaging	Het
Ltf	T	C	9: 111,020,912	M1T	probably null	Het
Ly75	C	T	2: 60,299,082	R1653H	probably benign	Het
Macrod2	T	C	2: 142,176,667	F240S	probably damaging	Het
Man1c1	T	C	4: 134,569,060	E433G	probably damaging	Het
Mansc4	A	T	6: 147,081,549	M130K	probably benign	Het
Mccc1	C	T	3: 35,990,048		probably null	Het
Mink1	G	T	11: 70,605,165	R75L	possibly damaging	Het
Mst1	A	G	9: 108,081,286	D65G	probably damaging	Het
Myo9b	C	T	8: 71,343,686	A857V	probably damaging	Het
Ndufa4	A	G	6: 11,900,575	V70A	probably benign	Het
Npat	T	A	9: 53,555,100	S230T	probably benign	Het
Nr1d1	A	G	11: 98,771,308	Y167H	probably damaging	Het
Oca2	A	G	7: 56,414,462	D735G	probably damaging	Het
Olfr13	T	C	6: 43,174,331	V115A	probably benign	Het
Olfr1359	C	T	13: 21,703,223	T74I	probably benign	Het
Olfr1383	A	G	11: 49,523,944	T74A	probably damaging	Het
Olfr835	T	A	9: 19,035,558	I145N	possibly damaging	Het
Otop1	A	G	5: 38,300,163	Y422C	probably damaging	Het
Pde4dip	G	A	3: 97,841,648	R126*	probably null	Het
Pdp2	C	T	8: 104,594,688	P390S	probably damaging	Het
Pds5b	A	T	5: 150,716,461	T14S	possibly damaging	Het
Pfkp	T	C	13: 6,588,595	E580G	probably damaging	Het
Piezo2	A	T	18: 63,117,696	L212Q	possibly damaging	Het
Piezo2	G	C	18: 63,117,697	L444V	probably benign	Het
Pla2g4d	T	A	2: 120,278,948	T207S	possibly damaging	Het
Plk2	C	A	13: 110,399,057	T471K	possibly damaging	Het
Ppp1r3g	G	A	13: 35,969,262	E222K	probably damaging	Het
Prkcg	A	G	7: 3,323,458	D480G	probably damaging	Het
Pxdc1	T	A	13: 34,652,195	T81S	probably benign	Het
Rnf150	A	T	8: 83,003,599	K253*	probably null	Het
Rsg1	C	T	4: 141,219,866	P186L	probably benign	Het
Sae1	T	C	7: 16,370,462		probably null	Het
Scin	C	T	12: 40,063,259	D538N	probably damaging	Het
Serpinb3c	C	A	1: 107,271,803	K329N	probably damaging	Het
Sgo2b	T	A	8: 63,926,974	K941N	possibly damaging	Het
Six1	C	T	12: 73,046,284	S48N	possibly damaging	Het
Slc39a8	G	A	3: 135,884,688	G381R	probably damaging	Het
Slc9b1	A	G	3: 135,357,559	K35E	unknown	Het
Srek1	C	T	13: 103,759,244	A274T	probably damaging	Het
Steap2	A	T	5: 5,677,497	Y279*	probably null	Het
Svil	T	A	18: 5,046,823	L110*	probably null	Het
Syncrip	T	C	9: 88,456,709		probably benign	Het
Tcf20	A	G	15: 82,853,242	I1336T	probably benign	Het
Tecpr1	T	A	5: 144,218,633	K36*	probably null	Het
Thbd	G	A	2: 148,407,366	T194I	probably damaging	Het
Tm9sf2	A	T	14: 122,151,962		probably null	Het
Tmtc4	A	T	14: 122,950,499	I225N	probably damaging	Het
Tpp1	C	T	7: 105,747,536	V425M	probably damaging	Het
Trbc2	T	A	6: 41,547,812	Y144*	probably null	Het
Trps1	T	C	15: 50,846,108	D282G	probably damaging	Het
Tsc22d4	T	A	5: 137,747,142	S9R	probably damaging	Het
Upp1	T	A	11: 9,136,025	D287E	probably benign	Het
Uso1	A	C	5: 92,201,299	Q916H	probably damaging	Het
Uty	T	A	Y: 1,134,902	Y884F	probably damaging	Het
Vmn1r222	T	C	13: 23,232,780	R88G	probably damaging	Het
Vmn1r79	T	C	7: 12,177,001	V270A	possibly damaging	Het
Zbtb22	T	C	17: 33,917,735	S285P	probably benign	Het
Zfp385a	A	G	15: 103,318,065	V82A	probably damaging	Het
Zfp59	T	C	7: 27,854,169	F349L	probably benign	Het
Zfp780b	T	G	7: 27,962,799	H777P	probably benign	Het
Zfp82	T	C	7: 30,057,124	T178A	probably benign	Het
Zfp850	T	C	7: 27,989,088	Y565C	probably damaging	Het
Zfp957	A	G	14: 79,212,767	Y531H	probably damaging	Het

Other mutations in Tenm2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00161:Tenm2	APN	11	36206899	splice site	probably benign
IGL00834:Tenm2	APN	11	36024258	missense	probably damaging	1.00
IGL00911:Tenm2	APN	11	36008733	nonsense	probably null
IGL00937:Tenm2	APN	11	36024623	missense	probably damaging	1.00
IGL01154:Tenm2	APN	11	36041544	missense	probably damaging	1.00
IGL01313:Tenm2	APN	11	36024248	missense	probably damaging	0.98
IGL01346:Tenm2	APN	11	36027405	nonsense	probably null
IGL01539:Tenm2	APN	11	36106827	missense	possibly damaging	0.89
IGL01629:Tenm2	APN	11	36864884	missense	probably damaging	0.98
IGL01780:Tenm2	APN	11	36046941	missense	probably benign
IGL01821:Tenm2	APN	11	36023883	missense	probably damaging	0.98
IGL01988:Tenm2	APN	11	36027251	missense	probably damaging	1.00
IGL02002:Tenm2	APN	11	36207095	missense	probably benign
IGL02449:Tenm2	APN	11	36023622	missense	probably damaging	0.99
IGL02505:Tenm2	APN	11	36051916	nonsense	probably null
IGL02649:Tenm2	APN	11	36207085	missense	possibly damaging	0.85
IGL02688:Tenm2	APN	11	36068458	missense	probably benign	0.05
IGL02801:Tenm2	APN	11	36047030	nonsense	probably null
IGL02928:Tenm2	APN	11	36027170	missense	possibly damaging	0.69
IGL02940:Tenm2	APN	11	36041644	missense	probably damaging	1.00
IGL03202:Tenm2	APN	11	36024548	missense	probably damaging	1.00
IGL03213:Tenm2	APN	11	36023330	missense	probably benign	0.05
IGL03276:Tenm2	APN	11	36072776	missense	possibly damaging	0.95
IGL03296:Tenm2	APN	11	36052025	splice site	probably null
IGL03381:Tenm2	APN	11	36068411	missense	probably benign	0.01
IGL03398:Tenm2	APN	11	36024543	missense	probably damaging	1.00
browser	UTSW	11	36046765	critical splice donor site	probably null
mosaic	UTSW	11	36063775	critical splice donor site	probably null
IGL02799:Tenm2	UTSW	11	36273408	missense	probably damaging	1.00
PIT4260001:Tenm2	UTSW	11	36163730	missense	probably damaging	1.00
PIT4382001:Tenm2	UTSW	11	36063902	missense	probably damaging	0.99
R0004:Tenm2	UTSW	11	36023357	missense	probably damaging	1.00
R0420:Tenm2	UTSW	11	36207124	splice site	probably benign
R0537:Tenm2	UTSW	11	36163730	missense	probably damaging	1.00
R0599:Tenm2	UTSW	11	36024780	missense	possibly damaging	0.93
R0636:Tenm2	UTSW	11	36943976	missense	probably damaging	1.00
R0693:Tenm2	UTSW	11	36024809	missense	probably damaging	1.00
R0991:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R0992:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1167:Tenm2	UTSW	11	36864684	missense	probably benign	0.30
R1177:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1178:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1179:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1180:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1181:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1193:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1194:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1195:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1195:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1195:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1259:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1265:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1267:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1268:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1269:Tenm2	UTSW	11	36008358	missense	possibly damaging	0.64
R1270:Tenm2	UTSW	11	36041659	missense	probably damaging	1.00
R1272:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1273:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1311:Tenm2	UTSW	11	36068594	splice site	probably benign
R1374:Tenm2	UTSW	11	36008454	missense	probably benign	0.00
R1542:Tenm2	UTSW	11	36300220	missense	probably damaging	0.99
R1573:Tenm2	UTSW	11	36047069	missense	probably damaging	1.00
R1579:Tenm2	UTSW	11	36106783	missense	probably damaging	1.00
R1697:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1722:Tenm2	UTSW	11	36008103	missense	probably damaging	1.00
R1756:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1793:Tenm2	UTSW	11	36023382	missense	probably damaging	0.99
R1950:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1954:Tenm2	UTSW	11	36047547	missense	possibly damaging	0.87
R2025:Tenm2	UTSW	11	36047264	nonsense	probably null
R2117:Tenm2	UTSW	11	36024854	missense	probably damaging	1.00
R2244:Tenm2	UTSW	11	36864862	missense	probably damaging	0.98
R2298:Tenm2	UTSW	11	36046777	missense	possibly damaging	0.62
R2432:Tenm2	UTSW	11	36027191	missense	probably damaging	1.00
R3014:Tenm2	UTSW	11	36023973	missense	probably damaging	1.00
R3115:Tenm2	UTSW	11	36023366	missense	probably damaging	1.00
R3684:Tenm2	UTSW	11	36051817	missense	probably benign	0.00
R3685:Tenm2	UTSW	11	36051817	missense	probably benign	0.00
R3705:Tenm2	UTSW	11	36068326	missense	probably damaging	0.97
R3820:Tenm2	UTSW	11	36024320	missense	probably damaging	0.98
R3821:Tenm2	UTSW	11	36024320	missense	probably damaging	0.98
R3822:Tenm2	UTSW	11	36024320	missense	probably damaging	0.98
R3844:Tenm2	UTSW	11	36047538	missense	probably damaging	0.98
R3878:Tenm2	UTSW	11	36139574	critical splice donor site	probably null
R4019:Tenm2	UTSW	11	36047074	missense	probably benign	0.04
R4062:Tenm2	UTSW	11	36008655	missense	probably damaging	1.00
R4367:Tenm2	UTSW	11	36027398	missense	probably benign
R4395:Tenm2	UTSW	11	36024624	missense	probably benign	0.23
R4508:Tenm2	UTSW	11	36008345	missense	possibly damaging	0.82
R4534:Tenm2	UTSW	11	36063104	missense	possibly damaging	0.64
R4539:Tenm2	UTSW	11	36046780	missense	probably damaging	1.00
R4644:Tenm2	UTSW	11	36047136	missense	probably benign	0.00
R4661:Tenm2	UTSW	11	36024448	missense	probably damaging	0.99
R4669:Tenm2	UTSW	11	36010487	missense	probably damaging	1.00
R4687:Tenm2	UTSW	11	36049097	missense	probably benign
R4711:Tenm2	UTSW	11	36300212	missense	probably damaging	0.98
R4816:Tenm2	UTSW	11	36027290	missense	probably damaging	1.00
R4843:Tenm2	UTSW	11	36024020	missense	probably damaging	1.00
R4850:Tenm2	UTSW	11	36023488	nonsense	probably null
R4870:Tenm2	UTSW	11	36078569	missense	probably damaging	1.00
R5058:Tenm2	UTSW	11	36207080	missense	possibly damaging	0.80
R5071:Tenm2	UTSW	11	36068381	missense	probably damaging	0.99
R5073:Tenm2	UTSW	11	36068381	missense	probably damaging	0.99
R5074:Tenm2	UTSW	11	36068381	missense	probably damaging	0.99
R5081:Tenm2	UTSW	11	36024633	missense	possibly damaging	0.95
R5093:Tenm2	UTSW	11	36944162	missense	probably damaging	1.00
R5170:Tenm2	UTSW	11	36024806	missense	probably damaging	0.98
R5253:Tenm2	UTSW	11	36047201	nonsense	probably null
R5343:Tenm2	UTSW	11	36069503	missense	probably benign	0.00
R5493:Tenm2	UTSW	11	36864676	missense	probably benign	0.01
R5600:Tenm2	UTSW	11	36163714	splice site	probably null
R5703:Tenm2	UTSW	11	36023799	missense	probably benign	0.34
R5707:Tenm2	UTSW	11	36047182	missense	possibly damaging	0.79
R6026:Tenm2	UTSW	11	36072729	critical splice donor site	probably null
R6063:Tenm2	UTSW	11	36163717	critical splice donor site	probably null
R6086:Tenm2	UTSW	11	36008646	missense	possibly damaging	0.64
R6151:Tenm2	UTSW	11	36008783	missense	probably damaging	1.00
R6169:Tenm2	UTSW	11	36139690	missense	probably damaging	0.99
R6193:Tenm2	UTSW	11	36046794	missense	probably damaging	1.00
R6405:Tenm2	UTSW	11	36864859	missense	probably benign	0.44
R6477:Tenm2	UTSW	11	36010507	critical splice acceptor site	probably null
R6607:Tenm2	UTSW	11	36063775	critical splice donor site	probably null
R6668:Tenm2	UTSW	11	36046765	critical splice donor site	probably null
R6825:Tenm2	UTSW	11	36046884	missense	probably benign	0.02
R6885:Tenm2	UTSW	11	36023580	missense	possibly damaging	0.95
R7017:Tenm2	UTSW	11	36171409	missense	probably damaging	0.98
R7115:Tenm2	UTSW	11	36163817	missense	probably damaging	0.99
R7153:Tenm2	UTSW	11	36024182	missense	probably damaging	0.98
R7173:Tenm2	UTSW	11	36041551	missense	probably damaging	0.99
R7199:Tenm2	UTSW	11	36171436	missense	probably damaging	1.00
R7205:Tenm2	UTSW	11	36049129	missense	probably damaging	0.99
R7250:Tenm2	UTSW	11	36072798	missense	probably damaging	1.00
R7290:Tenm2	UTSW	11	36023471	missense	probably damaging	1.00
R7366:Tenm2	UTSW	11	36069414	missense	probably benign	0.09
R7432:Tenm2	UTSW	11	36864941	missense	probably benign
R7504:Tenm2	UTSW	11	36139743	missense	probably damaging	1.00
R7513:Tenm2	UTSW	11	36051900	missense	probably benign	0.34
R7523:Tenm2	UTSW	11	36078581	splice site	probably null
R7527:Tenm2	UTSW	11	36206976	missense	probably damaging	1.00
R7648:Tenm2	UTSW	11	36106736	missense	probably damaging	1.00
R7653:Tenm2	UTSW	11	36047347	missense	probably benign	0.09
R7717:Tenm2	UTSW	11	36864935	missense	probably damaging	0.97
R7739:Tenm2	UTSW	11	36069561	missense	possibly damaging	0.50
R7762:Tenm2	UTSW	11	36023306	missense	possibly damaging	0.74
R7786:Tenm2	UTSW	11	36010449	missense	probably damaging	0.99
R7803:Tenm2	UTSW	11	36047116	missense	probably damaging	0.98
R7834:Tenm2	UTSW	11	36024854	missense	probably damaging	1.00
R7838:Tenm2	UTSW	11	36106799	missense	probably benign	0.02
R8073:Tenm2	UTSW	11	36139644	missense	possibly damaging	0.56
R8076:Tenm2	UTSW	11	36027221	missense	probably benign	0.23
R8109:Tenm2	UTSW	11	36008310	missense	probably benign
R8306:Tenm2	UTSW	11	36069369	missense	possibly damaging	0.52
R8352:Tenm2	UTSW	11	36023601	missense	probably damaging	0.98
R8452:Tenm2	UTSW	11	36023601	missense	probably damaging	0.98
R8864:Tenm2	UTSW	11	36027195	missense	possibly damaging	0.95
R8880:Tenm2	UTSW	11	36051961	missense	probably damaging	0.99
R8943:Tenm2	UTSW	11	36944034	missense	probably damaging	0.98
R8969:Tenm2	UTSW	11	36051861	missense	probably damaging	0.99
R9168:Tenm2	UTSW	11	36039895	missense	probably damaging	1.00
R9279:Tenm2	UTSW	11	36068476	missense	probably benign	0.00
R9294:Tenm2	UTSW	11	36024500	missense	probably damaging	0.98
R9320:Tenm2	UTSW	11	36023647	missense	probably damaging	0.99
R9373:Tenm2	UTSW	11	36039886	missense	probably damaging	1.00
R9408:Tenm2	UTSW	11	36069419	missense	probably damaging	1.00
R9410:Tenm2	UTSW	11	36141569	missense	probably damaging	0.99
R9454:Tenm2	UTSW	11	36221459	missense	probably benign
R9489:Tenm2	UTSW	11	36943964	missense	probably damaging	0.99
R9711:Tenm2	UTSW	11	36024514	missense	probably damaging	0.99
RF021:Tenm2	UTSW	11	36024203	missense	possibly damaging	0.95
X0018:Tenm2	UTSW	11	36024200	missense	probably damaging	1.00
X0063:Tenm2	UTSW	11	36024730	missense	probably benign
Z1088:Tenm2	UTSW	11	36273267	missense	probably damaging	1.00
Z1177:Tenm2	UTSW	11	36008234	missense	possibly damaging	0.95
Z1177:Tenm2	UTSW	11	36300335	missense	probably damaging	0.98
Z1177:Tenm2	UTSW	11	36385130	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TTCGGATCACAGCTGCAGAG -3'
(R):5'- AGACTCCATAGCTGACTCTTGC -3'

Sequencing Primer
(F):5'- TGCAGAGGCCGGAGTCAG -3'
(R):5'- ATAGCTGACTCTTGCTAACGG -3'

Posted On

2017-12-01