Incidental Mutation 'R5679:Ncan'
ID 501260
Institutional Source Beutler Lab
Gene Symbol Ncan
Ensembl Gene ENSMUSG00000002341
Gene Name neurocan
Synonyms Cspg3-rs, Tgfbit, Cspg3
MMRRC Submission 043176-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5679 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 70545735-70573494 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 70565276 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Serine at position 217 (Y217S)
Ref Sequence ENSEMBL: ENSMUSP00000002412 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002412]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000002412
AA Change: Y217S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000002412
Gene: ENSMUSG00000002341
AA Change: Y217S

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 23 30 N/A INTRINSIC
IG 43 157 9.63e-6 SMART
LINK 157 254 2.22e-56 SMART
LINK 258 356 4.72e-60 SMART
low complexity region 575 586 N/A INTRINSIC
low complexity region 602 632 N/A INTRINSIC
low complexity region 663 677 N/A INTRINSIC
EGF 963 996 6.5e-5 SMART
EGF_CA 998 1034 9.77e-9 SMART
CLECT 1040 1161 1.97e-41 SMART
CCP 1167 1223 2.53e-12 SMART
low complexity region 1225 1256 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Neurocan is a chondroitin sulfate proteoglycan thought to be involved in the modulation of cell adhesion and migration.[supplied by OMIM, Jul 2002]
PHENOTYPE: Mice homozygous for targeted null mutations are viable and fertile and exhibit normal behavior and brain anatomy; however, mild defects in long term potentiation were noted. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh3a1 G A 11: 61,107,994 (GRCm39) R346Q probably benign Het
Bcat1 A T 6: 144,953,474 (GRCm39) F304L probably damaging Het
Ccdc178 T G 18: 22,200,486 (GRCm39) K439N probably benign Het
Cdkn2a T C 4: 89,195,098 (GRCm39) D84G possibly damaging Het
Chst8 T A 7: 34,374,729 (GRCm39) H370L probably damaging Het
Dimt1 A G 13: 107,084,108 (GRCm39) T32A possibly damaging Het
Dph6 T C 2: 114,398,422 (GRCm39) I162V probably benign Het
E230025N22Rik C T 18: 36,818,435 (GRCm39) G465R possibly damaging Het
Fam3d T C 14: 8,349,305 (GRCm38) E215G probably damaging Het
Fbxw7 T A 3: 84,884,794 (GRCm39) N612K probably damaging Het
Gpr179 A G 11: 97,227,571 (GRCm39) V1528A probably benign Het
Gucy2g T A 19: 55,219,511 (GRCm39) K370N possibly damaging Het
Ipo13 A T 4: 117,752,029 (GRCm39) W903R probably damaging Het
Itgax T A 7: 127,734,162 (GRCm39) H311Q probably benign Het
Kmt2d T C 15: 98,752,153 (GRCm39) probably benign Het
Lox T C 18: 52,661,989 (GRCm39) N138S probably benign Het
Mre11a T A 9: 14,698,215 (GRCm39) I21N probably damaging Het
Nfil3 A G 13: 53,122,527 (GRCm39) F126L possibly damaging Het
Nfu1 T C 6: 86,996,379 (GRCm39) V110A probably damaging Het
Or12e8 T C 2: 87,187,889 (GRCm39) F34L possibly damaging Het
Or5e1 A G 7: 108,354,203 (GRCm39) I47V probably damaging Het
Or5g9 A T 2: 85,552,390 (GRCm39) I214F probably damaging Het
Palld T C 8: 62,137,979 (GRCm39) Q592R possibly damaging Het
Pcdhac1 T A 18: 37,225,530 (GRCm39) L781Q probably damaging Het
Rcl1 A G 19: 29,098,658 (GRCm39) probably null Het
Saxo1 C T 4: 86,363,272 (GRCm39) V404I possibly damaging Het
Scrt1 T A 15: 76,403,262 (GRCm39) T243S unknown Het
Slc22a30 G T 19: 8,313,135 (GRCm39) T550K possibly damaging Het
Strc A G 2: 121,198,581 (GRCm39) S1437P probably benign Het
Tecpr1 T A 5: 144,144,241 (GRCm39) I654F possibly damaging Het
Tfcp2l1 A G 1: 118,596,377 (GRCm39) M371V probably benign Het
Vmn2r11 T C 5: 109,202,708 (GRCm39) N123S probably benign Het
Wdr81 T C 11: 75,343,749 (GRCm39) D506G probably damaging Het
Xylt1 A G 7: 117,242,877 (GRCm39) D640G probably damaging Het
Zfp148 T G 16: 33,316,156 (GRCm39) M276R probably damaging Het
Zfp329 G A 7: 12,543,958 (GRCm39) T522I probably damaging Het
Other mutations in Ncan
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Ncan APN 8 70,567,921 (GRCm39) missense probably benign 0.24
IGL00924:Ncan APN 8 70,561,039 (GRCm39) missense possibly damaging 0.78
IGL01319:Ncan APN 8 70,550,212 (GRCm39) missense probably damaging 0.99
IGL01407:Ncan APN 8 70,554,607 (GRCm39) missense probably benign 0.17
IGL01528:Ncan APN 8 70,562,731 (GRCm39) missense probably benign 0.00
IGL01567:Ncan APN 8 70,560,984 (GRCm39) missense probably benign 0.09
IGL01808:Ncan APN 8 70,560,090 (GRCm39) critical splice donor site probably null
IGL02543:Ncan APN 8 70,561,221 (GRCm39) missense probably benign 0.37
IGL02551:Ncan APN 8 70,555,112 (GRCm39) missense probably damaging 1.00
IGL02899:Ncan APN 8 70,567,698 (GRCm39) missense possibly damaging 0.95
IGL02940:Ncan APN 8 70,562,735 (GRCm39) missense probably benign 0.02
IGL03058:Ncan APN 8 70,560,582 (GRCm39) missense possibly damaging 0.83
learned UTSW 8 70,550,731 (GRCm39) nonsense probably null
sagacious UTSW 8 70,565,240 (GRCm39) missense probably damaging 0.99
R0219:Ncan UTSW 8 70,567,984 (GRCm39) missense probably benign 0.08
R0538:Ncan UTSW 8 70,561,252 (GRCm39) missense possibly damaging 0.86
R0540:Ncan UTSW 8 70,567,809 (GRCm39) missense possibly damaging 0.93
R0854:Ncan UTSW 8 70,565,202 (GRCm39) missense probably damaging 1.00
R0918:Ncan UTSW 8 70,561,039 (GRCm39) missense possibly damaging 0.78
R1344:Ncan UTSW 8 70,560,819 (GRCm39) missense probably benign
R1575:Ncan UTSW 8 70,562,848 (GRCm39) missense probably benign 0.27
R1739:Ncan UTSW 8 70,560,736 (GRCm39) missense probably benign 0.03
R1847:Ncan UTSW 8 70,555,104 (GRCm39) missense probably damaging 0.96
R1859:Ncan UTSW 8 70,567,998 (GRCm39) missense possibly damaging 0.94
R2320:Ncan UTSW 8 70,560,868 (GRCm39) missense probably benign
R2370:Ncan UTSW 8 70,565,463 (GRCm39) missense probably benign 0.05
R3407:Ncan UTSW 8 70,564,801 (GRCm39) missense probably damaging 1.00
R3408:Ncan UTSW 8 70,564,801 (GRCm39) missense probably damaging 1.00
R3961:Ncan UTSW 8 70,562,950 (GRCm39) missense probably benign 0.05
R4155:Ncan UTSW 8 70,562,727 (GRCm39) missense possibly damaging 0.87
R4156:Ncan UTSW 8 70,562,727 (GRCm39) missense possibly damaging 0.87
R4365:Ncan UTSW 8 70,567,861 (GRCm39) missense probably damaging 1.00
R4858:Ncan UTSW 8 70,556,705 (GRCm39) missense probably benign 0.00
R4925:Ncan UTSW 8 70,562,604 (GRCm39) missense probably benign 0.02
R4942:Ncan UTSW 8 70,552,944 (GRCm39) missense probably damaging 1.00
R4976:Ncan UTSW 8 70,567,675 (GRCm39) missense probably damaging 0.98
R5119:Ncan UTSW 8 70,567,675 (GRCm39) missense probably damaging 0.98
R5141:Ncan UTSW 8 70,565,487 (GRCm39) missense probably damaging 1.00
R5706:Ncan UTSW 8 70,554,667 (GRCm39) missense probably damaging 0.99
R5915:Ncan UTSW 8 70,550,731 (GRCm39) nonsense probably null
R6033:Ncan UTSW 8 70,565,240 (GRCm39) missense probably damaging 0.99
R6033:Ncan UTSW 8 70,565,240 (GRCm39) missense probably damaging 0.99
R6223:Ncan UTSW 8 70,562,604 (GRCm39) missense probably benign 0.02
R6390:Ncan UTSW 8 70,567,899 (GRCm39) missense probably benign 0.34
R6533:Ncan UTSW 8 70,549,007 (GRCm39) missense probably benign 0.01
R6836:Ncan UTSW 8 70,552,965 (GRCm39) missense possibly damaging 0.84
R6869:Ncan UTSW 8 70,560,557 (GRCm39) missense probably benign 0.08
R7229:Ncan UTSW 8 70,552,961 (GRCm39) missense possibly damaging 0.69
R7232:Ncan UTSW 8 70,564,738 (GRCm39) missense probably damaging 1.00
R7293:Ncan UTSW 8 70,567,861 (GRCm39) missense probably damaging 0.98
R7406:Ncan UTSW 8 70,562,749 (GRCm39) missense probably benign 0.00
R7474:Ncan UTSW 8 70,554,691 (GRCm39) missense possibly damaging 0.53
R7779:Ncan UTSW 8 70,567,661 (GRCm39) missense probably damaging 0.99
R7973:Ncan UTSW 8 70,550,225 (GRCm39) missense probably benign 0.00
R8113:Ncan UTSW 8 70,561,221 (GRCm39) missense possibly damaging 0.58
R8269:Ncan UTSW 8 70,560,330 (GRCm39) missense probably benign 0.01
R8947:Ncan UTSW 8 70,555,171 (GRCm39) missense probably damaging 0.98
R9324:Ncan UTSW 8 70,560,648 (GRCm39) missense possibly damaging 0.75
R9717:Ncan UTSW 8 70,554,628 (GRCm39) missense probably damaging 1.00
R9803:Ncan UTSW 8 70,560,751 (GRCm39) missense probably benign 0.06
Z1177:Ncan UTSW 8 70,550,122 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCATGGGGCGTAGGAAATAC -3'
(R):5'- TGTCGCCTAAGCTCTGCTAC -3'

Sequencing Primer
(F):5'- TGGGACAGTACCTTACACTCACG -3'
(R):5'- AAGCTCTGCTACCATCGCTG -3'
Posted On 2017-12-01