Mutagenetix > Incidental Mutation

Incidental Mutation 'R5679:Ncan'

501260

Institutional Source

Beutler Lab

Gene Symbol

Ncan

Ensembl Gene

ENSMUSG00000002341

Gene Name

neurocan

Synonyms

Cspg3, Cspg3-rs, neurocan, Tgfbit

MMRRC Submission

043176-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5679 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

70093085-70120873 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 70112626 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Serine at position 217 (Y217S)

Ref Sequence

ENSEMBL: ENSMUSP00000002412 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000002412]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000002412
AA Change: Y217S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000002412
Gene: ENSMUSG00000002341
AA Change: Y217S

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
low complexity region	23	30	N/A	INTRINSIC
IG	43	157	9.63e-6	SMART
LINK	157	254	2.22e-56	SMART
LINK	258	356	4.72e-60	SMART
low complexity region	575	586	N/A	INTRINSIC
low complexity region	602	632	N/A	INTRINSIC
low complexity region	663	677	N/A	INTRINSIC
EGF	963	996	6.5e-5	SMART
EGF_CA	998	1034	9.77e-9	SMART
CLECT	1040	1161	1.97e-41	SMART
CCP	1167	1223	2.53e-12	SMART
low complexity region	1225	1256	N/A	INTRINSIC

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.6%
20x: 96.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Neurocan is a chondroitin sulfate proteoglycan thought to be involved in the modulation of cell adhesion and migration.[supplied by OMIM, Jul 2002]
PHENOTYPE: Mice homozygous for targeted null mutations are viable and fertile and exhibit normal behavior and brain anatomy; however, mild defects in long term potentiation were noted. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aldh3a1	G	A	11: 61,217,168	R346Q	probably benign	Het
Bcat1	A	T	6: 145,007,748	F304L	probably damaging	Het
Ccdc178	T	G	18: 22,067,429	K439N	probably benign	Het
Cdkn2a	T	C	4: 89,276,861	D84G	possibly damaging	Het
Chst8	T	A	7: 34,675,304	H370L	probably damaging	Het
Dimt1	A	G	13: 106,947,600	T32A	possibly damaging	Het
Dph6	T	C	2: 114,567,941	I162V	probably benign	Het
E230025N22Rik	C	T	18: 36,685,382	G465R	possibly damaging	Het
Fbxw7	T	A	3: 84,977,487	N612K	probably damaging	Het
Gpr179	A	G	11: 97,336,745	V1528A	probably benign	Het
Gucy2g	T	A	19: 55,231,079	K370N	possibly damaging	Het
Ipo13	A	T	4: 117,894,832	W903R	probably damaging	Het
Itgax	T	A	7: 128,134,990	H311Q	probably benign	Het
Kmt2d	T	C	15: 98,854,272		probably benign	Het
Lox	T	C	18: 52,528,917	N138S	probably benign	Het
Mre11a	T	A	9: 14,786,919	I21N	probably damaging	Het
Nfil3	A	G	13: 52,968,491	F126L	possibly damaging	Het
Nfu1	T	C	6: 87,019,397	V110A	probably damaging	Het
Oit1	T	C	14: 8,349,305	E215G	probably damaging	Het
Olfr1009	A	T	2: 85,722,046	I214F	probably damaging	Het
Olfr1120	T	C	2: 87,357,545	F34L	possibly damaging	Het
Olfr513	A	G	7: 108,754,996	I47V	probably damaging	Het
Palld	T	C	8: 61,684,945	Q592R	possibly damaging	Het
Pcdhac1	T	A	18: 37,092,477	L781Q	probably damaging	Het
Rcl1	A	G	19: 29,121,258		probably null	Het
Saxo1	C	T	4: 86,445,035	V404I	possibly damaging	Het
Scrt1	T	A	15: 76,519,062	T243S	unknown	Het
Slc22a30	G	T	19: 8,335,771	T550K	possibly damaging	Het
Strc	A	G	2: 121,368,100	S1437P	probably benign	Het
Tecpr1	T	A	5: 144,207,423	I654F	possibly damaging	Het
Tfcp2l1	A	G	1: 118,668,647	M371V	probably benign	Het
Vmn2r11	T	C	5: 109,054,842	N123S	probably benign	Het
Wdr81	T	C	11: 75,452,923	D506G	probably damaging	Het
Xylt1	A	G	7: 117,643,650	D640G	probably damaging	Het
Zfp148	T	G	16: 33,495,786	M276R	probably damaging	Het
Zfp329	G	A	7: 12,810,031	T522I	probably damaging	Het

Other mutations in Ncan

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00539:Ncan	APN	8	70115271	missense	probably benign	0.24
IGL00924:Ncan	APN	8	70108389	missense	possibly damaging	0.78
IGL01319:Ncan	APN	8	70097562	missense	probably damaging	0.99
IGL01407:Ncan	APN	8	70101957	missense	probably benign	0.17
IGL01528:Ncan	APN	8	70110081	missense	probably benign	0.00
IGL01567:Ncan	APN	8	70108334	missense	probably benign	0.09
IGL01808:Ncan	APN	8	70107440	critical splice donor site	probably null
IGL02543:Ncan	APN	8	70108571	missense	probably benign	0.37
IGL02551:Ncan	APN	8	70102462	missense	probably damaging	1.00
IGL02899:Ncan	APN	8	70115048	missense	possibly damaging	0.95
IGL02940:Ncan	APN	8	70110085	missense	probably benign	0.02
IGL03058:Ncan	APN	8	70107932	missense	possibly damaging	0.83
learned	UTSW	8	70098081	nonsense	probably null
sagacious	UTSW	8	70112590	missense	probably damaging	0.99
R0219:Ncan	UTSW	8	70115334	missense	probably benign	0.08
R0538:Ncan	UTSW	8	70108602	missense	possibly damaging	0.86
R0540:Ncan	UTSW	8	70115159	missense	possibly damaging	0.93
R0854:Ncan	UTSW	8	70112552	missense	probably damaging	1.00
R0918:Ncan	UTSW	8	70108389	missense	possibly damaging	0.78
R1344:Ncan	UTSW	8	70108169	missense	probably benign
R1575:Ncan	UTSW	8	70110198	missense	probably benign	0.27
R1739:Ncan	UTSW	8	70108086	missense	probably benign	0.03
R1847:Ncan	UTSW	8	70102454	missense	probably damaging	0.96
R1859:Ncan	UTSW	8	70115348	missense	possibly damaging	0.94
R2320:Ncan	UTSW	8	70108218	missense	probably benign
R2370:Ncan	UTSW	8	70112813	missense	probably benign	0.05
R3407:Ncan	UTSW	8	70112151	missense	probably damaging	1.00
R3408:Ncan	UTSW	8	70112151	missense	probably damaging	1.00
R3961:Ncan	UTSW	8	70110300	missense	probably benign	0.05
R4155:Ncan	UTSW	8	70110077	missense	possibly damaging	0.87
R4156:Ncan	UTSW	8	70110077	missense	possibly damaging	0.87
R4365:Ncan	UTSW	8	70115211	missense	probably damaging	1.00
R4858:Ncan	UTSW	8	70104055	missense	probably benign	0.00
R4925:Ncan	UTSW	8	70109954	missense	probably benign	0.02
R4942:Ncan	UTSW	8	70100294	missense	probably damaging	1.00
R4976:Ncan	UTSW	8	70115025	missense	probably damaging	0.98
R5119:Ncan	UTSW	8	70115025	missense	probably damaging	0.98
R5141:Ncan	UTSW	8	70112837	missense	probably damaging	1.00
R5706:Ncan	UTSW	8	70102017	missense	probably damaging	0.99
R5915:Ncan	UTSW	8	70098081	nonsense	probably null
R6033:Ncan	UTSW	8	70112590	missense	probably damaging	0.99
R6033:Ncan	UTSW	8	70112590	missense	probably damaging	0.99
R6223:Ncan	UTSW	8	70109954	missense	probably benign	0.02
R6390:Ncan	UTSW	8	70115249	missense	probably benign	0.34
R6533:Ncan	UTSW	8	70096357	missense	probably benign	0.01
R6836:Ncan	UTSW	8	70100315	missense	possibly damaging	0.84
R6869:Ncan	UTSW	8	70107907	missense	probably benign	0.08
R7229:Ncan	UTSW	8	70100311	missense	possibly damaging	0.69
R7232:Ncan	UTSW	8	70112088	missense	probably damaging	1.00
R7293:Ncan	UTSW	8	70115211	missense	probably damaging	0.98
R7406:Ncan	UTSW	8	70110099	missense	probably benign	0.00
R7474:Ncan	UTSW	8	70102041	missense	possibly damaging	0.53
R7779:Ncan	UTSW	8	70115011	missense	probably damaging	0.99
R7973:Ncan	UTSW	8	70097575	missense	probably benign	0.00
R8113:Ncan	UTSW	8	70108571	missense	possibly damaging	0.58
R8269:Ncan	UTSW	8	70107680	missense	probably benign	0.01
R8947:Ncan	UTSW	8	70102521	missense	probably damaging	0.98
R9324:Ncan	UTSW	8	70107998	missense	possibly damaging	0.75
R9717:Ncan	UTSW	8	70101978	missense	probably damaging	1.00
R9803:Ncan	UTSW	8	70108101	missense	probably benign	0.06
Z1177:Ncan	UTSW	8	70097472	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TCATGGGGCGTAGGAAATAC -3'
(R):5'- TGTCGCCTAAGCTCTGCTAC -3'

Sequencing Primer
(F):5'- TGGGACAGTACCTTACACTCACG -3'
(R):5'- AAGCTCTGCTACCATCGCTG -3'

Posted On

2017-12-01