Incidental Mutation 'R5680:Pik3c3'
ID501263
Institutional Source Beutler Lab
Gene Symbol Pik3c3
Ensembl Gene ENSMUSG00000033628
Gene Namephosphatidylinositol 3-kinase catalytic subunit type 3
Synonyms5330434F23Rik, Vps34
MMRRC Submission 043177-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5680 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location30272747-30348126 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 30277113 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 133 (Y133*)
Ref Sequence ENSEMBL: ENSMUSP00000128927 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091978] [ENSMUST00000115811] [ENSMUST00000115812] [ENSMUST00000131405]
Predicted Effect probably null
Transcript: ENSMUST00000091978
AA Change: Y133*
SMART Domains Protein: ENSMUSP00000089601
Gene: ENSMUSG00000033628
AA Change: Y133*

DomainStartEndE-ValueType
C2 20 141 4.44e0 SMART
PI3K_C2 21 130 1.43e-42 SMART
PI3Ka 283 530 3.08e-111 SMART
PI3Kc 632 848 1.02e-84 SMART
Predicted Effect probably null
Transcript: ENSMUST00000115811
AA Change: Y133*
SMART Domains Protein: ENSMUSP00000111478
Gene: ENSMUSG00000033628
AA Change: Y133*

DomainStartEndE-ValueType
C2 20 141 4.44e0 SMART
PI3K_C2 21 130 1.43e-42 SMART
PI3Ka 283 530 3.08e-111 SMART
PI3Kc 632 756 5.33e-8 SMART
Predicted Effect probably null
Transcript: ENSMUST00000115812
AA Change: Y133*
SMART Domains Protein: ENSMUSP00000111479
Gene: ENSMUSG00000033628
AA Change: Y133*

DomainStartEndE-ValueType
C2 20 141 4.44e0 SMART
PI3K_C2 21 130 1.43e-42 SMART
PI3Ka 283 530 3.08e-111 SMART
PI3Kc 632 884 1.21e-118 SMART
Predicted Effect probably null
Transcript: ENSMUST00000131405
AA Change: Y133*
SMART Domains Protein: ENSMUSP00000128927
Gene: ENSMUSG00000033628
AA Change: Y133*

DomainStartEndE-ValueType
C2 20 141 4.44e0 SMART
PI3K_C2 21 130 1.43e-42 SMART
PI3Ka 283 506 1.78e-84 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele display embryonic lethality between implantation and placentation, arrest prior to gastrulation, and show reduced cell proliferation. Mice homozygous for a conditional allele activated in T cells exhibit impaired naive Tcell homeostasis and mitophagy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T A 14: 32,662,053 R652W probably damaging Het
Abca6 A G 11: 110,236,645 F362S possibly damaging Het
Adcy1 G A 11: 7,109,020 V309M probably damaging Het
Agap2 A G 10: 127,088,011 K752E unknown Het
Ahdc1 T A 4: 133,065,596 F1383I probably benign Het
Ano5 G A 7: 51,583,814 R658H possibly damaging Het
Atn1 A T 6: 124,747,815 S152T possibly damaging Het
Bcl11a G A 11: 24,164,264 V536M possibly damaging Het
Cdc20 T C 4: 118,433,067 T466A probably damaging Het
Cecr2 C G 6: 120,761,426 T1010R probably benign Het
Cfap54 A T 10: 92,979,017 L1318* probably null Het
Colec11 A G 12: 28,594,731 S249P probably damaging Het
Dnah6 A G 6: 73,149,525 V1273A probably damaging Het
Fam208a CGCGGCGGCGGCGGCGG CGCGGCGGCGGCGGCGGCGGCGG 14: 27,429,123 probably benign Het
G3bp2 T C 5: 92,068,360 R106G probably damaging Het
Ggt7 A T 2: 155,506,433 C100S probably damaging Het
Gm765 T A 6: 98,248,226 Q32L probably damaging Het
Grik4 A T 9: 42,629,119 M255K probably benign Het
Kcnj11 A T 7: 46,098,808 S364T probably benign Het
Lnpep A T 17: 17,579,182 Y70* probably null Het
Mark1 T C 1: 184,944,816 H79R probably damaging Het
Myo9b T G 8: 71,290,372 S26A probably benign Het
Pa2g4 G T 10: 128,559,457 N306K probably benign Het
Prpf6 G T 2: 181,649,140 A675S probably damaging Het
Psca A G 15: 74,716,099 D44G probably benign Het
Sag T A 1: 87,821,337 F153I possibly damaging Het
Scn10a A G 9: 119,624,136 L1231P probably damaging Het
Sirpa T C 2: 129,616,252 S157P probably benign Het
Slc27a2 A T 2: 126,561,610 R184S probably benign Het
Tagln2 T C 1: 172,505,912 F111S probably damaging Het
Tbc1d1 A G 5: 64,324,544 D696G possibly damaging Het
Tert T A 13: 73,642,351 probably null Het
Togaram2 G A 17: 71,689,209 R68K probably benign Het
Trim40 A T 17: 36,888,982 I68N probably damaging Het
Trpa1 T C 1: 14,875,854 M1018V probably benign Het
Unc13c A T 9: 73,932,602 N322K probably damaging Het
Vmn2r75 T A 7: 86,171,571 T52S probably benign Het
Vmn2r90 T G 17: 17,726,772 V437G possibly damaging Het
Vps16 C A 2: 130,440,324 H389N possibly damaging Het
Other mutations in Pik3c3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Pik3c3 APN 18 30303078 splice site probably benign
IGL00743:Pik3c3 APN 18 30274364 missense probably damaging 1.00
IGL01622:Pik3c3 APN 18 30290525 nonsense probably null
IGL01622:Pik3c3 APN 18 30293049 splice site probably benign
IGL01623:Pik3c3 APN 18 30290525 nonsense probably null
IGL01623:Pik3c3 APN 18 30293049 splice site probably benign
IGL01773:Pik3c3 APN 18 30277102 missense probably damaging 1.00
IGL01917:Pik3c3 APN 18 30274446 missense probably damaging 1.00
IGL02033:Pik3c3 APN 18 30312650 missense possibly damaging 0.85
IGL02465:Pik3c3 APN 18 30344060 missense probably damaging 0.97
IGL03161:Pik3c3 APN 18 30293707 missense probably benign 0.37
IGL03221:Pik3c3 APN 18 30302931 missense probably benign 0.45
H8786:Pik3c3 UTSW 18 30294343 missense probably damaging 0.99
R0089:Pik3c3 UTSW 18 30303078 splice site probably benign
R1512:Pik3c3 UTSW 18 30322236 critical splice donor site probably null
R1713:Pik3c3 UTSW 18 30323586 missense possibly damaging 0.73
R1758:Pik3c3 UTSW 18 30277010 missense probably damaging 1.00
R1822:Pik3c3 UTSW 18 30344077 critical splice donor site probably null
R1870:Pik3c3 UTSW 18 30293132 critical splice donor site probably null
R2680:Pik3c3 UTSW 18 30344078 critical splice donor site probably null
R3768:Pik3c3 UTSW 18 30333273 missense probably damaging 1.00
R3926:Pik3c3 UTSW 18 30311329 splice site probably benign
R4154:Pik3c3 UTSW 18 30311283 missense probably benign 0.35
R4293:Pik3c3 UTSW 18 30343990 missense probably damaging 1.00
R4570:Pik3c3 UTSW 18 30290550 missense possibly damaging 0.94
R4858:Pik3c3 UTSW 18 30344078 critical splice donor site probably null
R4893:Pik3c3 UTSW 18 30282000 missense probably benign 0.16
R4901:Pik3c3 UTSW 18 30302929 missense possibly damaging 0.65
R5216:Pik3c3 UTSW 18 30272976 missense probably damaging 1.00
R5358:Pik3c3 UTSW 18 30323544 missense probably damaging 1.00
R5373:Pik3c3 UTSW 18 30312561 missense probably benign 0.40
R5374:Pik3c3 UTSW 18 30312561 missense probably benign 0.40
R5600:Pik3c3 UTSW 18 30311293 missense probably damaging 1.00
R5965:Pik3c3 UTSW 18 30298580 missense probably damaging 1.00
R6492:Pik3c3 UTSW 18 30324562 missense probably damaging 1.00
R6576:Pik3c3 UTSW 18 30342741 intron probably benign
R6700:Pik3c3 UTSW 18 30316901 missense probably benign 0.02
R7523:Pik3c3 UTSW 18 30293655 missense probably damaging 1.00
R7883:Pik3c3 UTSW 18 30274363 missense probably benign 0.04
R7884:Pik3c3 UTSW 18 30312571 missense probably benign 0.00
R7886:Pik3c3 UTSW 18 30319588 nonsense probably null
R8075:Pik3c3 UTSW 18 30305029 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGTCTGAACCACCTTTTATGGG -3'
(R):5'- CAGTAGACAGTGTTTTCATTTAGCTGC -3'

Sequencing Primer
(F):5'- GAACCACCTTTTATGGGTTAATTTG -3'
(R):5'- ACATGTGATCCCATCAGGTG -3'
Posted On2017-12-01