Incidental Mutation 'R5685:Psme4'
ID 501281
Institutional Source Beutler Lab
Gene Symbol Psme4
Ensembl Gene ENSMUSG00000040850
Gene Name proteasome (prosome, macropain) activator subunit 4
Synonyms
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5685 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 30721726-30830361 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 30759837 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Aspartic acid at position 320 (G320D)
Ref Sequence ENSEMBL: ENSMUSP00000045460 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041231]
AlphaFold Q5SSW2
Predicted Effect probably damaging
Transcript: ENSMUST00000041231
AA Change: G320D

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000045460
Gene: ENSMUSG00000040850
AA Change: G320D

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
low complexity region 122 133 N/A INTRINSIC
Pfam:BLM10_mid 330 828 8.8e-119 PFAM
SCOP:d1b3ua_ 1183 1716 3e-14 SMART
Pfam:DUF3437 1756 1843 5.3e-39 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133430
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele show normal repair of DNA double-strand breaks but exhibit significantly reduced male fertility due to defects in spermatogenesis observed in both meiotic spermatocytes and postmeiotic haploid spermatids. [provided by MGI curators]
Allele List at MGI

All alleles(25) : Targeted, knock-out(1) Gene trapped(24)

Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028J19Rik T A 7: 43,879,974 (GRCm39) probably benign Het
Abcb5 A T 12: 118,896,348 (GRCm39) probably null Het
Abcg1 G T 17: 31,317,260 (GRCm39) E191* probably null Het
Als2 A G 1: 59,218,250 (GRCm39) Y1263H possibly damaging Het
Amer2 T A 14: 60,617,026 (GRCm39) L281* probably null Het
Anxa6 T C 11: 54,887,196 (GRCm39) N361D probably benign Het
Ap1g1 A T 8: 110,564,415 (GRCm39) N320I probably damaging Het
Aqr T C 2: 113,986,746 (GRCm39) D208G possibly damaging Het
Arnt2 T C 7: 83,912,473 (GRCm39) T545A probably benign Het
Aspm G A 1: 139,415,026 (GRCm39) V2701I probably benign Het
Atad2 A G 15: 57,980,194 (GRCm39) V106A possibly damaging Het
Bbs2 A C 8: 94,814,061 (GRCm39) F186V probably damaging Het
Catsperg2 G A 7: 29,400,613 (GRCm39) P247L probably damaging Het
Cfap57 G T 4: 118,426,656 (GRCm39) Q1098K probably benign Het
Cxcr6 A G 9: 123,639,811 (GRCm39) T271A probably benign Het
Dock1 A G 7: 134,374,091 (GRCm39) E579G probably benign Het
Frem3 A G 8: 81,421,932 (GRCm39) T2111A probably damaging Het
Galnt1 A T 18: 24,397,586 (GRCm39) D229V possibly damaging Het
Gbp2b A C 3: 142,313,919 (GRCm39) M400L probably benign Het
Gm1123 T A 9: 98,891,486 (GRCm39) probably null Het
Gtpbp6 T C 5: 110,252,805 (GRCm39) H349R probably damaging Het
Hyal5 A G 6: 24,876,691 (GRCm39) K188R probably benign Het
Insrr T C 3: 87,707,803 (GRCm39) probably null Het
Kcnn1 A T 8: 71,305,374 (GRCm39) C322S probably damaging Het
Kdelr1 GTCTA G 7: 45,531,041 (GRCm39) probably null Het
Kif23 T C 9: 61,852,691 (GRCm39) T8A probably benign Het
Lrrk2 A T 15: 91,687,504 (GRCm39) R2198* probably null Het
Mcl1 T G 3: 95,567,109 (GRCm39) D177E possibly damaging Het
Mrps11 A T 7: 78,441,628 (GRCm39) T137S probably benign Het
Mtbp A G 15: 55,426,168 (GRCm39) Y90C probably damaging Het
Nkpd1 C T 7: 19,257,498 (GRCm39) Q276* probably null Het
Nxt1 G T 2: 148,517,673 (GRCm39) W138L possibly damaging Het
Or5al1 T C 2: 85,990,139 (GRCm39) T192A probably damaging Het
Or5h17 T A 16: 58,820,709 (GRCm39) F220L probably benign Het
Or5t17 T A 2: 86,832,621 (GRCm39) S103T probably benign Het
Osbpl7 C A 11: 96,951,103 (GRCm39) P478H probably damaging Het
Phf8-ps T A 17: 33,285,746 (GRCm39) H352L probably benign Het
Pitpna T A 11: 75,511,095 (GRCm39) F222I probably damaging Het
Plekhh2 A T 17: 84,877,310 (GRCm39) R552W probably damaging Het
Plxnb2 C T 15: 89,051,235 (GRCm39) R328H probably damaging Het
Pmaip1 C T 18: 66,594,055 (GRCm39) T65I probably benign Het
Ppil4 T G 10: 7,674,186 (GRCm39) I110S probably damaging Het
Prpf38a A G 4: 108,427,351 (GRCm39) probably null Het
Rab17 C A 1: 90,886,679 (GRCm39) R191L probably benign Het
Rhag A T 17: 41,142,222 (GRCm39) M222L possibly damaging Het
Rims2 A T 15: 39,300,602 (GRCm39) H111L possibly damaging Het
Setx T C 2: 29,061,292 (GRCm39) Y2234H probably damaging Het
Slc2a8 T C 2: 32,871,801 (GRCm39) I51V possibly damaging Het
Slc34a1 T C 13: 55,549,085 (GRCm39) probably null Het
Slf1 T C 13: 77,231,598 (GRCm39) T594A possibly damaging Het
Sox6 A T 7: 115,178,392 (GRCm39) probably null Het
Spata13 C T 14: 60,928,652 (GRCm39) S70L probably benign Het
Stard13 A G 5: 150,986,592 (GRCm39) I188T possibly damaging Het
Stard9 A G 2: 120,535,803 (GRCm39) D4020G probably damaging Het
Tdp1 A G 12: 99,868,611 (GRCm39) K255R possibly damaging Het
Tns2 G T 15: 102,015,538 (GRCm39) A124S probably benign Het
Top2b T A 14: 16,413,666 (GRCm38) W1045R probably damaging Het
Trav12-2 T C 14: 53,854,122 (GRCm39) V32A probably damaging Het
Vps13c G T 9: 67,870,455 (GRCm39) R3198L possibly damaging Het
Wee1 TCCCC TCCC 7: 109,723,776 (GRCm39) probably null Het
Zfp52 T A 17: 21,782,013 (GRCm39) S620R probably benign Het
Zfp62 T A 11: 49,107,044 (GRCm39) C378* probably null Het
Zfp638 C A 6: 83,906,969 (GRCm39) P378H probably damaging Het
Other mutations in Psme4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Psme4 APN 11 30,765,710 (GRCm39) critical splice donor site probably null
IGL00401:Psme4 APN 11 30,771,079 (GRCm39) splice site probably benign
IGL00475:Psme4 APN 11 30,795,252 (GRCm39) missense probably benign 0.14
IGL00576:Psme4 APN 11 30,773,145 (GRCm39) missense possibly damaging 0.50
IGL00817:Psme4 APN 11 30,770,129 (GRCm39) missense probably benign 0.01
IGL01525:Psme4 APN 11 30,759,936 (GRCm39) splice site probably benign
IGL01862:Psme4 APN 11 30,762,038 (GRCm39) nonsense probably null
IGL02310:Psme4 APN 11 30,787,484 (GRCm39) missense probably benign 0.06
IGL02477:Psme4 APN 11 30,792,083 (GRCm39) missense probably damaging 0.99
IGL02545:Psme4 APN 11 30,791,586 (GRCm39) missense possibly damaging 0.81
IGL02608:Psme4 APN 11 30,770,944 (GRCm39) missense probably benign 0.34
IGL02621:Psme4 APN 11 30,798,131 (GRCm39) missense probably benign
IGL02822:Psme4 APN 11 30,798,204 (GRCm39) unclassified probably benign
IGL02833:Psme4 APN 11 30,800,715 (GRCm39) unclassified probably benign
IGL02964:Psme4 APN 11 30,741,095 (GRCm39) nonsense probably null
IGL03273:Psme4 APN 11 30,798,130 (GRCm39) missense probably damaging 1.00
IGL03348:Psme4 APN 11 30,826,796 (GRCm39) missense probably damaging 1.00
IGL03382:Psme4 APN 11 30,757,788 (GRCm39) missense possibly damaging 0.94
H2330:Psme4 UTSW 11 30,801,210 (GRCm39) missense probably benign 0.17
PIT4378001:Psme4 UTSW 11 30,771,079 (GRCm39) splice site probably benign
R0276:Psme4 UTSW 11 30,761,980 (GRCm39) missense probably damaging 1.00
R0462:Psme4 UTSW 11 30,798,117 (GRCm39) missense probably damaging 1.00
R0685:Psme4 UTSW 11 30,828,415 (GRCm39) missense probably damaging 1.00
R0766:Psme4 UTSW 11 30,757,687 (GRCm39) splice site probably null
R0830:Psme4 UTSW 11 30,757,797 (GRCm39) missense possibly damaging 0.53
R0940:Psme4 UTSW 11 30,765,264 (GRCm39) missense possibly damaging 0.53
R1018:Psme4 UTSW 11 30,754,310 (GRCm39) missense probably damaging 1.00
R1312:Psme4 UTSW 11 30,757,687 (GRCm39) splice site probably null
R1448:Psme4 UTSW 11 30,802,744 (GRCm39) missense probably damaging 1.00
R1713:Psme4 UTSW 11 30,756,310 (GRCm39) missense probably damaging 1.00
R1732:Psme4 UTSW 11 30,798,105 (GRCm39) missense probably benign 0.03
R1813:Psme4 UTSW 11 30,754,353 (GRCm39) missense probably benign 0.14
R1905:Psme4 UTSW 11 30,760,922 (GRCm39) missense probably damaging 1.00
R1907:Psme4 UTSW 11 30,760,922 (GRCm39) missense probably damaging 1.00
R1911:Psme4 UTSW 11 30,765,658 (GRCm39) missense probably benign 0.02
R1956:Psme4 UTSW 11 30,782,424 (GRCm39) missense probably damaging 0.99
R1974:Psme4 UTSW 11 30,769,011 (GRCm39) missense probably benign 0.00
R1980:Psme4 UTSW 11 30,782,615 (GRCm39) missense possibly damaging 0.84
R1986:Psme4 UTSW 11 30,780,352 (GRCm39) missense probably benign 0.01
R2046:Psme4 UTSW 11 30,767,723 (GRCm39) splice site probably benign
R2142:Psme4 UTSW 11 30,770,998 (GRCm39) missense possibly damaging 0.89
R2698:Psme4 UTSW 11 30,824,282 (GRCm39) critical splice donor site probably null
R2844:Psme4 UTSW 11 30,795,173 (GRCm39) splice site probably benign
R3807:Psme4 UTSW 11 30,806,027 (GRCm39) splice site probably null
R3876:Psme4 UTSW 11 30,806,068 (GRCm39) missense probably damaging 0.99
R4420:Psme4 UTSW 11 30,762,028 (GRCm39) missense possibly damaging 0.67
R4584:Psme4 UTSW 11 30,784,318 (GRCm39) missense probably damaging 1.00
R4615:Psme4 UTSW 11 30,784,287 (GRCm39) missense probably benign 0.02
R4714:Psme4 UTSW 11 30,782,573 (GRCm39) missense probably benign 0.02
R5008:Psme4 UTSW 11 30,806,896 (GRCm39) intron probably benign
R5109:Psme4 UTSW 11 30,741,095 (GRCm39) nonsense probably null
R5155:Psme4 UTSW 11 30,826,806 (GRCm39) missense probably damaging 1.00
R5199:Psme4 UTSW 11 30,803,272 (GRCm39) missense probably benign 0.00
R5205:Psme4 UTSW 11 30,782,666 (GRCm39) intron probably benign
R5452:Psme4 UTSW 11 30,741,168 (GRCm39) missense probably benign
R5491:Psme4 UTSW 11 30,765,246 (GRCm39) missense possibly damaging 0.63
R5764:Psme4 UTSW 11 30,722,364 (GRCm39) intron probably benign
R5853:Psme4 UTSW 11 30,741,234 (GRCm39) critical splice donor site probably null
R5865:Psme4 UTSW 11 30,741,993 (GRCm39) missense possibly damaging 0.95
R5903:Psme4 UTSW 11 30,791,589 (GRCm39) missense probably benign 0.28
R5927:Psme4 UTSW 11 30,754,294 (GRCm39) missense possibly damaging 0.82
R6004:Psme4 UTSW 11 30,806,896 (GRCm39) intron probably benign
R6102:Psme4 UTSW 11 30,815,567 (GRCm39) missense probably damaging 1.00
R6247:Psme4 UTSW 11 30,803,245 (GRCm39) missense possibly damaging 0.60
R6527:Psme4 UTSW 11 30,782,175 (GRCm39) missense probably benign
R6750:Psme4 UTSW 11 30,803,203 (GRCm39) missense probably damaging 1.00
R6885:Psme4 UTSW 11 30,784,307 (GRCm39) nonsense probably null
R6939:Psme4 UTSW 11 30,787,291 (GRCm39) missense probably damaging 0.99
R6945:Psme4 UTSW 11 30,787,437 (GRCm39) missense probably benign 0.06
R7029:Psme4 UTSW 11 30,722,474 (GRCm39) intron probably benign
R7049:Psme4 UTSW 11 30,763,904 (GRCm39) splice site probably null
R7098:Psme4 UTSW 11 30,800,661 (GRCm39) missense probably damaging 0.99
R7107:Psme4 UTSW 11 30,798,105 (GRCm39) missense probably benign 0.03
R7223:Psme4 UTSW 11 30,824,226 (GRCm39) missense probably benign 0.33
R7319:Psme4 UTSW 11 30,757,790 (GRCm39) missense probably benign 0.00
R7375:Psme4 UTSW 11 30,722,700 (GRCm39) splice site probably null
R7410:Psme4 UTSW 11 30,765,279 (GRCm39) nonsense probably null
R7469:Psme4 UTSW 11 30,752,837 (GRCm39) missense probably benign 0.20
R7651:Psme4 UTSW 11 30,787,334 (GRCm39) missense probably damaging 0.98
R7679:Psme4 UTSW 11 30,828,425 (GRCm39) missense probably damaging 0.99
R7681:Psme4 UTSW 11 30,741,975 (GRCm39) missense possibly damaging 0.63
R7822:Psme4 UTSW 11 30,824,245 (GRCm39) missense probably benign
R8013:Psme4 UTSW 11 30,754,320 (GRCm39) missense probably benign 0.06
R8130:Psme4 UTSW 11 30,792,026 (GRCm39) missense probably damaging 1.00
R8323:Psme4 UTSW 11 30,793,532 (GRCm39) missense probably damaging 0.99
R8330:Psme4 UTSW 11 30,793,583 (GRCm39) missense probably benign 0.00
R8363:Psme4 UTSW 11 30,762,139 (GRCm39) missense probably damaging 1.00
R8491:Psme4 UTSW 11 30,722,161 (GRCm39) missense possibly damaging 0.90
R8690:Psme4 UTSW 11 30,787,319 (GRCm39) missense probably benign 0.00
R8696:Psme4 UTSW 11 30,759,896 (GRCm39) missense probably damaging 0.99
R8743:Psme4 UTSW 11 30,828,467 (GRCm39) missense probably damaging 1.00
R8998:Psme4 UTSW 11 30,788,957 (GRCm39) missense possibly damaging 0.78
R9241:Psme4 UTSW 11 30,815,576 (GRCm39) missense probably damaging 1.00
R9657:Psme4 UTSW 11 30,788,980 (GRCm39) missense probably benign 0.00
R9736:Psme4 UTSW 11 30,797,411 (GRCm39) missense probably damaging 0.99
R9744:Psme4 UTSW 11 30,765,294 (GRCm39) critical splice donor site probably null
R9746:Psme4 UTSW 11 30,826,868 (GRCm39) nonsense probably null
V5088:Psme4 UTSW 11 30,801,210 (GRCm39) missense probably benign 0.17
X0063:Psme4 UTSW 11 30,782,600 (GRCm39) missense possibly damaging 0.66
Z1176:Psme4 UTSW 11 30,793,522 (GRCm39) missense possibly damaging 0.87
Z1177:Psme4 UTSW 11 30,762,138 (GRCm39) missense probably damaging 1.00
Z1177:Psme4 UTSW 11 30,756,311 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATTTGTGCAAAGATTACTAGGGAG -3'
(R):5'- TTGATCTAACCACTTACACATAGCC -3'

Sequencing Primer
(F):5'- TGTGCAAAGATTACTAGGGAGTTATG -3'
(R):5'- GCCAAAGCTTACATGACAGATAAG -3'
Posted On 2017-12-01