Mutagenetix > Incidental Mutation

Incidental Mutation 'R5685:Psme4'

501281

Institutional Source

Beutler Lab

Gene Symbol

Psme4

Ensembl Gene

ENSMUSG00000040850

Gene Name

proteasome (prosome, macropain) activator subunit 4

Synonyms

Accession Numbers

Genbank: NM_134013

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5685 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

30771726-30880361 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 30809837 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Aspartic acid at position 320 (G320D)

Ref Sequence

ENSEMBL: ENSMUSP00000045460 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041231]

AlphaFold

Q5SSW2

Predicted Effect

probably damaging
Transcript: ENSMUST00000041231
AA Change: G320D

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000045460
Gene: ENSMUSG00000040850
AA Change: G320D

Domain	Start	End	E-Value	Type
low complexity region	2	19	N/A	INTRINSIC
low complexity region	122	133	N/A	INTRINSIC
Pfam:BLM10_mid	330	828	8.8e-119	PFAM
SCOP:d1b3ua_	1183	1716	3e-14	SMART
Pfam:DUF3437	1756	1843	5.3e-39	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133430

Coding Region Coverage

1x: 99.6%
3x: 98.8%
10x: 97.0%
20x: 94.1%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele show normal repair of DNA double-strand breaks but exhibit significantly reduced male fertility due to defects in spermatogenesis observed in both meiotic spermatocytes and postmeiotic haploid spermatids. [provided by MGI curators]

Allele List at MGI

All alleles(25) : Targeted, knock-out(1) Gene trapped(24)

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700028J19Rik	T	A	7: 44,230,550		probably benign	Het
4921501E09Rik	T	A	17: 33,066,772	H352L	probably benign	Het
Abcb5	A	T	12: 118,932,613		probably null	Het
Abcg1	G	T	17: 31,098,286	E191*	probably null	Het
Als2	A	G	1: 59,179,091	Y1263H	possibly damaging	Het
Amer2	T	A	14: 60,379,577	L281*	probably null	Het
Anxa6	T	C	11: 54,996,370	N361D	probably benign	Het
Ap1g1	A	T	8: 109,837,783	N320I	probably damaging	Het
Aqr	T	C	2: 114,156,265	D208G	possibly damaging	Het
Arnt2	T	C	7: 84,263,265	T545A	probably benign	Het
Aspm	G	A	1: 139,487,288	V2701I	probably benign	Het
Atad2	A	G	15: 58,116,798	V106A	possibly damaging	Het
Bbs2	A	C	8: 94,087,433	F186V	probably damaging	Het
Catsperg2	G	A	7: 29,701,188	P247L	probably damaging	Het
Cfap57	G	T	4: 118,569,459	Q1098K	probably benign	Het
Cxcr6	A	G	9: 123,810,746	T271A	probably benign	Het
Dock1	A	G	7: 134,772,362	E579G	probably benign	Het
Frem3	A	G	8: 80,695,303	T2111A	probably damaging	Het
Galnt1	A	T	18: 24,264,529	D229V	possibly damaging	Het
Gbp2b	A	C	3: 142,608,158	M400L	probably benign	Het
Gm1123	T	A	9: 99,009,433		probably null	Het
Gtpbp6	T	C	5: 110,104,939	H349R	probably damaging	Het
Hyal5	A	G	6: 24,876,692	K188R	probably benign	Het
Insrr	T	C	3: 87,800,496		probably null	Het
Kcnn1	A	T	8: 70,852,730	C322S	probably damaging	Het
Kdelr1	GTCTA	G	7: 45,881,617		probably null	Het
Kif23	T	C	9: 61,945,409	T8A	probably benign	Het
Lrrk2	A	T	15: 91,803,301	R2198*	probably null	Het
Mcl1	T	G	3: 95,659,798	D177E	possibly damaging	Het
Mrps11	A	T	7: 78,791,880	T137S	probably benign	Het
Mtbp	A	G	15: 55,562,772	Y90C	probably damaging	Het
Nkpd1	C	T	7: 19,523,573	Q276*	probably null	Het
Nxt1	G	T	2: 148,675,753	W138L	possibly damaging	Het
Olfr1042	T	C	2: 86,159,795	T192A	probably damaging	Het
Olfr1102	T	A	2: 87,002,277	S103T	probably benign	Het
Olfr183	T	A	16: 59,000,346	F220L	probably benign	Het
Osbpl7	C	A	11: 97,060,277	P478H	probably damaging	Het
Pitpna	T	A	11: 75,620,269	F222I	probably damaging	Het
Plekhh2	A	T	17: 84,569,882	R552W	probably damaging	Het
Plxnb2	C	T	15: 89,167,032	R328H	probably damaging	Het
Pmaip1	C	T	18: 66,460,984	T65I	probably benign	Het
Ppil4	T	G	10: 7,798,422	I110S	probably damaging	Het
Prpf38a	A	G	4: 108,570,154		probably null	Het
Rab17	C	A	1: 90,958,957	R191L	probably benign	Het
Rhag	A	T	17: 40,831,331	M222L	possibly damaging	Het
Rims2	A	T	15: 39,437,206	H111L	possibly damaging	Het
Setx	T	C	2: 29,171,280	Y2234H	probably damaging	Het
Slc2a8	T	C	2: 32,981,789	I51V	possibly damaging	Het
Slc34a1	T	C	13: 55,401,272		probably null	Het
Slf1	T	C	13: 77,083,479	T594A	possibly damaging	Het
Sox6	A	T	7: 115,579,157		probably null	Het
Spata13	C	T	14: 60,691,203	S70L	probably benign	Het
Stard13	A	G	5: 151,063,127	I188T	possibly damaging	Het
Stard9	A	G	2: 120,705,322	D4020G	probably damaging	Het
Tdp1	A	G	12: 99,902,352	K255R	possibly damaging	Het
Tns2	G	T	15: 102,107,103	A124S	probably benign	Het
Top2b	T	A	14: 16,413,666	W1045R	probably damaging	Het
Trav12-2	T	C	14: 53,616,665	V32A	probably damaging	Het
Vps13c	G	T	9: 67,963,173	R3198L	possibly damaging	Het
Wee1	TCCCC	TCCC	7: 110,124,569		probably null	Het
Zfp52	T	A	17: 21,561,751	S620R	probably benign	Het
Zfp62	T	A	11: 49,216,217	C378*	probably null	Het
Zfp638	C	A	6: 83,929,987	P378H	probably damaging	Het

Other mutations in Psme4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00228:Psme4	APN	11	30815710	critical splice donor site	probably null
IGL00401:Psme4	APN	11	30821079	splice site	probably benign
IGL00475:Psme4	APN	11	30845252	missense	probably benign	0.14
IGL00576:Psme4	APN	11	30823145	missense	possibly damaging	0.50
IGL00817:Psme4	APN	11	30820129	missense	probably benign	0.01
IGL01525:Psme4	APN	11	30809936	splice site	probably benign
IGL01862:Psme4	APN	11	30812038	nonsense	probably null
IGL02310:Psme4	APN	11	30837484	missense	probably benign	0.06
IGL02477:Psme4	APN	11	30842083	missense	probably damaging	0.99
IGL02545:Psme4	APN	11	30841586	missense	possibly damaging	0.81
IGL02608:Psme4	APN	11	30820944	missense	probably benign	0.34
IGL02621:Psme4	APN	11	30848131	missense	probably benign
IGL02822:Psme4	APN	11	30848204	unclassified	probably benign
IGL02833:Psme4	APN	11	30850715	unclassified	probably benign
IGL02964:Psme4	APN	11	30791095	nonsense	probably null
IGL03273:Psme4	APN	11	30848130	missense	probably damaging	1.00
IGL03348:Psme4	APN	11	30876796	missense	probably damaging	1.00
IGL03382:Psme4	APN	11	30807788	missense	possibly damaging	0.94
H2330:Psme4	UTSW	11	30851210	missense	probably benign	0.17
PIT4378001:Psme4	UTSW	11	30821079	splice site	probably benign
R0276:Psme4	UTSW	11	30811980	missense	probably damaging	1.00
R0462:Psme4	UTSW	11	30848117	missense	probably damaging	1.00
R0685:Psme4	UTSW	11	30878415	missense	probably damaging	1.00
R0766:Psme4	UTSW	11	30807687	splice site	probably null
R0830:Psme4	UTSW	11	30807797	missense	possibly damaging	0.53
R0940:Psme4	UTSW	11	30815264	missense	possibly damaging	0.53
R1018:Psme4	UTSW	11	30804310	missense	probably damaging	1.00
R1312:Psme4	UTSW	11	30807687	splice site	probably null
R1448:Psme4	UTSW	11	30852744	missense	probably damaging	1.00
R1713:Psme4	UTSW	11	30806310	missense	probably damaging	1.00
R1732:Psme4	UTSW	11	30848105	missense	probably benign	0.03
R1813:Psme4	UTSW	11	30804353	missense	probably benign	0.14
R1905:Psme4	UTSW	11	30810922	missense	probably damaging	1.00
R1907:Psme4	UTSW	11	30810922	missense	probably damaging	1.00
R1911:Psme4	UTSW	11	30815658	missense	probably benign	0.02
R1956:Psme4	UTSW	11	30832424	missense	probably damaging	0.99
R1974:Psme4	UTSW	11	30819011	missense	probably benign	0.00
R1980:Psme4	UTSW	11	30832615	missense	possibly damaging	0.84
R1986:Psme4	UTSW	11	30830352	missense	probably benign	0.01
R2046:Psme4	UTSW	11	30817723	splice site	probably benign
R2142:Psme4	UTSW	11	30820998	missense	possibly damaging	0.89
R2698:Psme4	UTSW	11	30874282	critical splice donor site	probably null
R2844:Psme4	UTSW	11	30845173	splice site	probably benign
R3807:Psme4	UTSW	11	30856027	splice site	probably null
R3876:Psme4	UTSW	11	30856068	missense	probably damaging	0.99
R4420:Psme4	UTSW	11	30812028	missense	possibly damaging	0.67
R4584:Psme4	UTSW	11	30834318	missense	probably damaging	1.00
R4615:Psme4	UTSW	11	30834287	missense	probably benign	0.02
R4714:Psme4	UTSW	11	30832573	missense	probably benign	0.02
R5008:Psme4	UTSW	11	30856896	intron	probably benign
R5109:Psme4	UTSW	11	30791095	nonsense	probably null
R5155:Psme4	UTSW	11	30876806	missense	probably damaging	1.00
R5199:Psme4	UTSW	11	30853272	missense	probably benign	0.00
R5205:Psme4	UTSW	11	30832666	intron	probably benign
R5452:Psme4	UTSW	11	30791168	missense	probably benign
R5491:Psme4	UTSW	11	30815246	missense	possibly damaging	0.63
R5764:Psme4	UTSW	11	30772364	intron	probably benign
R5853:Psme4	UTSW	11	30791234	critical splice donor site	probably null
R5865:Psme4	UTSW	11	30791993	missense	possibly damaging	0.95
R5903:Psme4	UTSW	11	30841589	missense	probably benign	0.28
R5927:Psme4	UTSW	11	30804294	missense	possibly damaging	0.82
R6004:Psme4	UTSW	11	30856896	intron	probably benign
R6102:Psme4	UTSW	11	30865567	missense	probably damaging	1.00
R6247:Psme4	UTSW	11	30853245	missense	possibly damaging	0.60
R6527:Psme4	UTSW	11	30832175	missense	probably benign
R6750:Psme4	UTSW	11	30853203	missense	probably damaging	1.00
R6885:Psme4	UTSW	11	30834307	nonsense	probably null
R6939:Psme4	UTSW	11	30837291	missense	probably damaging	0.99
R6945:Psme4	UTSW	11	30837437	missense	probably benign	0.06
R7029:Psme4	UTSW	11	30772474	intron	probably benign
R7049:Psme4	UTSW	11	30813904	splice site	probably null
R7098:Psme4	UTSW	11	30850661	missense	probably damaging	0.99
R7107:Psme4	UTSW	11	30848105	missense	probably benign	0.03
R7223:Psme4	UTSW	11	30874226	missense	probably benign	0.33
R7319:Psme4	UTSW	11	30807790	missense	probably benign	0.00
R7375:Psme4	UTSW	11	30772700	splice site	probably null
R7410:Psme4	UTSW	11	30815279	nonsense	probably null
R7469:Psme4	UTSW	11	30802837	missense	probably benign	0.20
R7651:Psme4	UTSW	11	30837334	missense	probably damaging	0.98
R7679:Psme4	UTSW	11	30878425	missense	probably damaging	0.99
R7681:Psme4	UTSW	11	30791975	missense	possibly damaging	0.63
R7822:Psme4	UTSW	11	30874245	missense	probably benign
R8013:Psme4	UTSW	11	30804320	missense	probably benign	0.06
R8130:Psme4	UTSW	11	30842026	missense	probably damaging	1.00
R8323:Psme4	UTSW	11	30843532	missense	probably damaging	0.99
R8330:Psme4	UTSW	11	30843583	missense	probably benign	0.00
R8363:Psme4	UTSW	11	30812139	missense	probably damaging	1.00
R8491:Psme4	UTSW	11	30772161	missense	possibly damaging	0.90
R8690:Psme4	UTSW	11	30837319	missense	probably benign	0.00
R8696:Psme4	UTSW	11	30809896	missense	probably damaging	0.99
R8743:Psme4	UTSW	11	30878467	missense	probably damaging	1.00
R8998:Psme4	UTSW	11	30838957	missense	possibly damaging	0.78
R9241:Psme4	UTSW	11	30865576	missense	probably damaging	1.00
R9657:Psme4	UTSW	11	30838980	missense	probably benign	0.00
R9736:Psme4	UTSW	11	30847411	missense	probably damaging	0.99
R9744:Psme4	UTSW	11	30815294	critical splice donor site	probably null
R9746:Psme4	UTSW	11	30876868	nonsense	probably null
V5088:Psme4	UTSW	11	30851210	missense	probably benign	0.17
X0063:Psme4	UTSW	11	30832600	missense	possibly damaging	0.66
Z1176:Psme4	UTSW	11	30843522	missense	possibly damaging	0.87
Z1177:Psme4	UTSW	11	30806311	missense	probably damaging	1.00
Z1177:Psme4	UTSW	11	30812138	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GATTTGTGCAAAGATTACTAGGGAG -3'
(R):5'- TTGATCTAACCACTTACACATAGCC -3'

Sequencing Primer
(F):5'- TGTGCAAAGATTACTAGGGAGTTATG -3'
(R):5'- GCCAAAGCTTACATGACAGATAAG -3'

Posted On

2017-12-01