Incidental Mutation 'R5642:Trpm6'
ID501282
Institutional Source Beutler Lab
Gene Symbol Trpm6
Ensembl Gene ENSMUSG00000024727
Gene Nametransient receptor potential cation channel, subfamily M, member 6
SynonymsCHAK2
MMRRC Submission 043290-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5642 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location18749983-18892510 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 18830207 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 1039 (C1039S)
Ref Sequence ENSEMBL: ENSMUSP00000037443 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040489]
Predicted Effect probably damaging
Transcript: ENSMUST00000040489
AA Change: C1039S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037443
Gene: ENSMUSG00000024727
AA Change: C1039S

DomainStartEndE-ValueType
Blast:ANK 430 459 4e-8 BLAST
low complexity region 580 604 N/A INTRINSIC
transmembrane domain 749 766 N/A INTRINSIC
Pfam:Ion_trans 847 1087 2.8e-13 PFAM
low complexity region 1113 1126 N/A INTRINSIC
low complexity region 1136 1154 N/A INTRINSIC
Pfam:TRPM_tetra 1176 1231 7.5e-27 PFAM
low complexity region 1320 1331 N/A INTRINSIC
low complexity region 1578 1596 N/A INTRINSIC
Blast:Alpha_kinase 1618 1673 9e-11 BLAST
low complexity region 1682 1695 N/A INTRINSIC
Alpha_kinase 1761 1978 1e-84 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is predominantly expressed in the kidney and colon, and encodes a protein containing an ion channel domain and a protein kinase domain. It is crucial for magnesium homeostasis, and plays an essential role in epithelial magnesium transport and in the active magnesium absorption in the gut and kidney. Mutations in this gene are associated with hypomagnesemia with secondary hypocalcemia. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic and postnatal lethality with exencephaly, spina bifida occulta, and abnormal brain and facial development. Mice heterozygous for a knock-out allele exhibit some premature death and decreased serummagnesium. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik T C 4: 42,971,831 L388P possibly damaging Het
4930432K21Rik C T 8: 84,167,485 T427I probably damaging Het
4932415D10Rik T A 10: 82,284,483 Q4231L probably damaging Het
Abcc1 A G 16: 14,443,455 E699G probably damaging Het
Ap4e1 T A 2: 127,064,979 V1053D possibly damaging Het
Apobec1 T A 6: 122,581,497 I100F probably damaging Het
Atp6v1g3 G T 1: 138,283,742 K53N probably damaging Het
Bag3 C T 7: 128,546,106 R482W probably damaging Het
Cacna1i A G 15: 80,395,078 T2007A possibly damaging Het
Cd44 T C 2: 102,901,342 D2G probably damaging Het
Cdadc1 T A 14: 59,589,923 I100F possibly damaging Het
Cdh16 A G 8: 104,618,045 F485L probably damaging Het
Cdhr5 T A 7: 141,269,197 K817* probably null Het
Cfap46 G T 7: 139,678,577 P260Q probably damaging Het
Clec11a C T 7: 44,306,408 E72K possibly damaging Het
Cnr2 C A 4: 135,916,765 N51K probably damaging Het
Col3a1 T A 1: 45,331,712 probably benign Het
Cxcr1 G A 1: 74,191,828 T345M probably damaging Het
Cyp2s1 T C 7: 25,816,319 probably null Het
Dalrd3 C T 9: 108,572,290 T474M probably damaging Het
Ddit4 C T 10: 59,951,505 S3N probably benign Het
Ddx41 T C 13: 55,535,895 K108E possibly damaging Het
Ece2 A T 16: 20,643,727 H732L probably benign Het
Etv3 T G 3: 87,536,015 L302R possibly damaging Het
Fam135b A G 15: 71,462,136 S1070P probably damaging Het
Fam160a2 A T 7: 105,389,882 I50N probably damaging Het
Gm11567 T A 11: 99,879,611 I125N unknown Het
Grm3 A G 5: 9,570,536 L236P probably benign Het
Hip1 T A 5: 135,433,085 R97* probably null Het
Hoxa5 T C 6: 52,204,217 Y45C probably damaging Het
Ighg1 T A 12: 113,329,034 H305L probably damaging Het
Inpp5b T A 4: 124,782,436 C362S probably benign Het
Kif1c A G 11: 70,708,447 K391E probably benign Het
Klf9 T C 19: 23,141,882 V43A probably benign Het
Krt28 T A 11: 99,374,494 I116F probably damaging Het
Lct A T 1: 128,295,232 D1439E probably damaging Het
Liph G A 16: 21,965,995 T284M possibly damaging Het
Lrrc75b T C 10: 75,557,221 K98R possibly damaging Het
Lypd4 T C 7: 24,865,179 Q178R probably benign Het
Map1a T A 2: 121,306,043 S2209T probably damaging Het
Map3k21 C T 8: 125,938,824 T584I probably benign Het
Map3k6 T C 4: 133,245,544 V338A probably damaging Het
Mapk8ip3 A T 17: 24,903,311 V699E possibly damaging Het
Marc1 A C 1: 184,810,919 S71A probably damaging Het
Nckap1l T C 15: 103,455,025 S53P probably benign Het
Nt5e T C 9: 88,327,687 M1T probably null Het
Nudt22 T C 19: 6,995,528 H64R probably damaging Het
Olfr1048 T C 2: 86,235,932 N294S probably damaging Het
Olfr108 A T 17: 37,445,772 T84S probably damaging Het
Olfr198 A G 16: 59,202,006 L140P probably damaging Het
Olfr314 A T 11: 58,786,828 Y198F probably damaging Het
Olfr322 T C 11: 58,666,399 I280T possibly damaging Het
Olfr690 A T 7: 105,329,565 V209D probably damaging Het
Otogl T C 10: 107,886,552 I314V probably benign Het
Pan2 G T 10: 128,308,100 E106D probably benign Het
Papss1 T A 3: 131,631,804 Y554* probably null Het
Pcnx T C 12: 81,895,029 V67A possibly damaging Het
Pdpk1 A C 17: 24,106,855 Y122* probably null Het
Pkd1l1 A T 11: 8,879,202 N1463K probably damaging Het
Ptgfrn C A 3: 101,043,362 M878I probably damaging Het
Ranbp3 G A 17: 56,710,703 G453E probably benign Het
Rapgef2 T C 3: 79,094,850 D261G probably damaging Het
Reep2 A G 18: 34,846,218 S199G probably benign Het
Rnpep G A 1: 135,277,521 T202I probably damaging Het
Sass6 T A 3: 116,607,496 probably null Het
Sema3e A G 5: 14,162,243 D111G probably damaging Het
Slc29a4 A G 5: 142,711,972 E60G probably damaging Het
Sptlc3 T C 2: 139,546,408 Y107H probably damaging Het
Stx6 T C 1: 155,198,179 I245T probably benign Het
Syne2 T C 12: 75,918,532 S774P probably damaging Het
Tbc1d16 T A 11: 119,158,791 Q293L probably damaging Het
Tbc1d30 T C 10: 121,296,787 D224G probably damaging Het
Tbc1d32 T A 10: 56,150,877 N759Y possibly damaging Het
Tdrd12 G T 7: 35,511,300 A166E probably damaging Het
Tex14 A G 11: 87,514,220 R653G probably benign Het
Them6 A T 15: 74,721,805 R171W probably null Het
Tln2 T C 9: 67,296,358 T489A probably benign Het
Tmem87a A G 2: 120,403,946 F39L probably benign Het
Toporsl T A 4: 52,611,515 C469* probably null Het
Tpr T C 1: 150,423,818 S1147P probably damaging Het
Trp53bp1 T C 2: 121,236,662 M528V probably benign Het
Ttc16 T A 2: 32,775,336 S5C probably damaging Het
Ttn T C 2: 76,787,068 Y14607C probably damaging Het
Usp6nl T C 2: 6,430,464 F345L probably damaging Het
Vmn1r205 C T 13: 22,592,036 G299R probably benign Het
Vmn2r74 G A 7: 85,957,380 H253Y probably benign Het
Vps13d A T 4: 145,170,302 D343E possibly damaging Het
Vwf A G 6: 125,603,418 E543G Het
Wdr92 A G 11: 17,227,263 N207S possibly damaging Het
Zfat A T 15: 68,180,916 V343E probably damaging Het
Zfp316 T C 5: 143,264,091 E139G unknown Het
Zfp943 T A 17: 21,992,832 C300S probably damaging Het
Zkscan16 A G 4: 58,957,748 K677E probably benign Het
Other mutations in Trpm6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:Trpm6 APN 19 18783908 splice site probably benign
IGL00862:Trpm6 APN 19 18827528 missense probably damaging 1.00
IGL01348:Trpm6 APN 19 18877651 missense probably damaging 1.00
IGL01400:Trpm6 APN 19 18825794 nonsense probably null
IGL01451:Trpm6 APN 19 18809569 missense probably damaging 1.00
IGL01508:Trpm6 APN 19 18796530 nonsense probably null
IGL01995:Trpm6 APN 19 18830327 splice site probably benign
IGL02092:Trpm6 APN 19 18772331 missense possibly damaging 0.59
IGL02152:Trpm6 APN 19 18832539 missense possibly damaging 0.93
IGL02294:Trpm6 APN 19 18854063 missense probably benign
IGL02329:Trpm6 APN 19 18854217 missense probably benign 0.17
IGL02366:Trpm6 APN 19 18778510 splice site probably benign
IGL02402:Trpm6 APN 19 18786756 missense probably benign 0.18
IGL02457:Trpm6 APN 19 18825791 missense probably damaging 1.00
IGL02457:Trpm6 APN 19 18827398 nonsense probably null
IGL02684:Trpm6 APN 19 18802207 splice site probably benign
IGL02705:Trpm6 APN 19 18776733 critical splice donor site probably null
IGL02728:Trpm6 APN 19 18809652 missense possibly damaging 0.71
IGL02742:Trpm6 APN 19 18830012 splice site probably benign
IGL02818:Trpm6 APN 19 18866257 missense probably benign 0.04
IGL02836:Trpm6 APN 19 18813482 missense probably damaging 1.00
IGL03119:Trpm6 APN 19 18838017 nonsense probably null
IGL03193:Trpm6 APN 19 18825872 missense possibly damaging 0.94
IGL03227:Trpm6 APN 19 18819119 missense probably benign 0.01
IGL03227:Trpm6 APN 19 18786779 missense probably benign 0.12
IGL03231:Trpm6 APN 19 18819181 missense probably benign
IGL03245:Trpm6 APN 19 18877701 missense probably damaging 1.00
IGL03328:Trpm6 APN 19 18838082 missense possibly damaging 0.94
IGL03341:Trpm6 APN 19 18813486 missense probably benign
P0043:Trpm6 UTSW 19 18877765 missense probably damaging 1.00
PIT4260001:Trpm6 UTSW 19 18825802 missense possibly damaging 0.48
R0057:Trpm6 UTSW 19 18786755 missense probably benign 0.05
R0115:Trpm6 UTSW 19 18829952 missense probably damaging 0.98
R0119:Trpm6 UTSW 19 18832593 missense probably benign 0.05
R0140:Trpm6 UTSW 19 18819194 splice site probably null
R0267:Trpm6 UTSW 19 18823378 missense probably benign
R0350:Trpm6 UTSW 19 18883957 splice site probably null
R0373:Trpm6 UTSW 19 18853587 missense probably benign 0.15
R0393:Trpm6 UTSW 19 18778644 missense probably damaging 0.99
R0416:Trpm6 UTSW 19 18783025 splice site probably benign
R0505:Trpm6 UTSW 19 18873902 splice site probably benign
R0526:Trpm6 UTSW 19 18792876 missense probably damaging 0.97
R0607:Trpm6 UTSW 19 18872221 missense probably benign 0.00
R0609:Trpm6 UTSW 19 18825862 missense probably damaging 0.97
R0714:Trpm6 UTSW 19 18838087 missense possibly damaging 0.90
R1215:Trpm6 UTSW 19 18796498 missense probably damaging 1.00
R1474:Trpm6 UTSW 19 18796495 missense probably benign 0.28
R1512:Trpm6 UTSW 19 18875931 missense probably benign
R1558:Trpm6 UTSW 19 18786828 missense probably benign 0.04
R1597:Trpm6 UTSW 19 18827524 missense probably damaging 0.98
R1618:Trpm6 UTSW 19 18877631 missense possibly damaging 0.88
R1779:Trpm6 UTSW 19 18856217 missense probably damaging 1.00
R1796:Trpm6 UTSW 19 18827567 missense possibly damaging 0.90
R1799:Trpm6 UTSW 19 18891999 splice site probably null
R1840:Trpm6 UTSW 19 18866267 missense probably benign 0.21
R1991:Trpm6 UTSW 19 18796284 missense probably benign 0.00
R2030:Trpm6 UTSW 19 18854265 missense probably benign
R2073:Trpm6 UTSW 19 18876042 missense probably damaging 1.00
R2074:Trpm6 UTSW 19 18877739 missense probably damaging 1.00
R2096:Trpm6 UTSW 19 18825752 missense probably damaging 0.97
R2103:Trpm6 UTSW 19 18796284 missense probably benign 0.00
R2106:Trpm6 UTSW 19 18813350 missense possibly damaging 0.95
R2117:Trpm6 UTSW 19 18829952 missense probably damaging 0.98
R2850:Trpm6 UTSW 19 18792090 missense possibly damaging 0.68
R3125:Trpm6 UTSW 19 18854431 missense probably benign 0.05
R3719:Trpm6 UTSW 19 18772393 nonsense probably null
R3779:Trpm6 UTSW 19 18876039 missense possibly damaging 0.80
R4115:Trpm6 UTSW 19 18832557 missense probably damaging 1.00
R4367:Trpm6 UTSW 19 18827525 missense probably damaging 0.99
R4523:Trpm6 UTSW 19 18796500 missense probably damaging 1.00
R4546:Trpm6 UTSW 19 18832477 missense probably damaging 1.00
R4564:Trpm6 UTSW 19 18832597 missense possibly damaging 0.95
R4565:Trpm6 UTSW 19 18825872 missense probably damaging 1.00
R4697:Trpm6 UTSW 19 18853791 missense probably benign 0.01
R4714:Trpm6 UTSW 19 18854200 missense possibly damaging 0.93
R4750:Trpm6 UTSW 19 18876064 missense probably damaging 0.99
R4771:Trpm6 UTSW 19 18813493 missense probably damaging 0.97
R4791:Trpm6 UTSW 19 18867981 missense probably benign 0.00
R4814:Trpm6 UTSW 19 18862212 missense probably benign 0.11
R5028:Trpm6 UTSW 19 18786760 missense probably damaging 1.00
R5237:Trpm6 UTSW 19 18813464 missense probably damaging 1.00
R5615:Trpm6 UTSW 19 18829933 missense probably damaging 0.96
R5645:Trpm6 UTSW 19 18853604 missense probably damaging 1.00
R5726:Trpm6 UTSW 19 18853617 missense probably damaging 1.00
R5832:Trpm6 UTSW 19 18786819 missense possibly damaging 0.66
R5843:Trpm6 UTSW 19 18856175 missense probably benign 0.04
R5955:Trpm6 UTSW 19 18892019 missense possibly damaging 0.75
R6101:Trpm6 UTSW 19 18853748 nonsense probably null
R6105:Trpm6 UTSW 19 18853748 nonsense probably null
R6211:Trpm6 UTSW 19 18783128 missense probably damaging 1.00
R6228:Trpm6 UTSW 19 18854291 missense probably damaging 1.00
R6263:Trpm6 UTSW 19 18854108 missense possibly damaging 0.94
R6453:Trpm6 UTSW 19 18829990 missense probably damaging 1.00
R6562:Trpm6 UTSW 19 18838042 missense probably damaging 1.00
R6624:Trpm6 UTSW 19 18796439 critical splice acceptor site probably null
R6624:Trpm6 UTSW 19 18889020 missense probably damaging 1.00
R6729:Trpm6 UTSW 19 18830297 missense probably damaging 1.00
R6765:Trpm6 UTSW 19 18877765 missense probably damaging 1.00
R6976:Trpm6 UTSW 19 18783163 missense probably benign
R7103:Trpm6 UTSW 19 18813547 missense possibly damaging 0.87
R7126:Trpm6 UTSW 19 18854033 nonsense probably null
R7128:Trpm6 UTSW 19 18811773 missense possibly damaging 0.92
R7157:Trpm6 UTSW 19 18838098 missense possibly damaging 0.91
R7212:Trpm6 UTSW 19 18853791 missense probably benign 0.01
R7263:Trpm6 UTSW 19 18876786 missense probably damaging 1.00
R7268:Trpm6 UTSW 19 18778585 missense probably benign 0.13
R7305:Trpm6 UTSW 19 18876091 missense probably benign 0.30
R7498:Trpm6 UTSW 19 18876120 missense probably damaging 1.00
R7558:Trpm6 UTSW 19 18778665 missense probably damaging 0.96
R7590:Trpm6 UTSW 19 18832581 missense probably benign 0.31
R7646:Trpm6 UTSW 19 18867961 missense probably benign 0.10
R7650:Trpm6 UTSW 19 18876013 missense possibly damaging 0.70
R7727:Trpm6 UTSW 19 18854249 missense probably damaging 0.97
R7743:Trpm6 UTSW 19 18827408 missense probably benign 0.03
R7747:Trpm6 UTSW 19 18750045 splice site probably null
R7807:Trpm6 UTSW 19 18829856 missense probably benign 0.11
R7870:Trpm6 UTSW 19 18815241 missense probably benign 0.01
R7891:Trpm6 UTSW 19 18776710 missense probably benign 0.01
R7955:Trpm6 UTSW 19 18854290 missense probably benign 0.01
R7965:Trpm6 UTSW 19 18876110 missense probably damaging 1.00
R7967:Trpm6 UTSW 19 18778659 missense probably damaging 0.99
R7992:Trpm6 UTSW 19 18815350 missense probably damaging 1.00
R8035:Trpm6 UTSW 19 18792862 missense probably damaging 0.97
R8108:Trpm6 UTSW 19 18811790 missense probably damaging 1.00
R8268:Trpm6 UTSW 19 18873861 missense possibly damaging 0.85
R8411:Trpm6 UTSW 19 18853968 missense probably benign 0.39
R8413:Trpm6 UTSW 19 18832485 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CGTGACATCGTCTTTGAGCC -3'
(R):5'- AATATAGCTGCTCCCCTGTTTTGG -3'

Sequencing Primer
(F):5'- GTTTTGCCTTCACTCAGAATCAGAAC -3'
(R):5'- AAGAGGTAGACAGCTTGC -3'
Posted On2017-12-01