Mutagenetix > Incidental Mutation

Incidental Mutation 'R5686:Igsf9b'

501285

Institutional Source

Beutler Lab

Gene Symbol

Igsf9b

Ensembl Gene

ENSMUSG00000034275

Gene Name

immunoglobulin superfamily, member 9B

Synonyms

LOC235086

MMRRC Submission

043319-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.504) question?

Stock #

R5686 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

27299204-27357546 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 27324179 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 508 (T508A)

Ref Sequence

ENSEMBL: ENSMUSP00000149356 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000115247] [ENSMUST00000133213] [ENSMUST00000214357]

AlphaFold

E9PZ19

Predicted Effect

probably damaging
Transcript: ENSMUST00000115247
AA Change: T508A

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000110902
Gene: ENSMUSG00000034275
AA Change: T508A

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
IG	30	134	9.41e-9	SMART
IGc2	152	215	1.82e-15	SMART
FN3	232	302	7.02e1	SMART
IGc2	241	310	3.01e-7	SMART
IG	331	417	2.79e-2	SMART
IGc2	433	495	5.48e-10	SMART
FN3	510	591	1.35e-7	SMART
FN3	615	695	3.08e-2	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000133213
AA Change: T508A

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000117017
Gene: ENSMUSG00000034275
AA Change: T508A

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
IG	30	134	9.41e-9	SMART
IGc2	152	215	1.82e-15	SMART
FN3	232	302	7.02e1	SMART
IGc2	241	310	3.01e-7	SMART
IG	331	417	2.79e-2	SMART
IGc2	433	495	5.48e-10	SMART
FN3	510	591	1.35e-7	SMART
FN3	615	695	3.08e-2	SMART
transmembrane domain	727	749	N/A	INTRINSIC
low complexity region	750	760	N/A	INTRINSIC
low complexity region	835	843	N/A	INTRINSIC
low complexity region	971	982	N/A	INTRINSIC
low complexity region	990	1001	N/A	INTRINSIC
low complexity region	1148	1161	N/A	INTRINSIC
low complexity region	1172	1190	N/A	INTRINSIC
low complexity region	1246	1273	N/A	INTRINSIC
low complexity region	1284	1296	N/A	INTRINSIC
low complexity region	1313	1326	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000214187

Predicted Effect

probably damaging
Transcript: ENSMUST00000214357
AA Change: T508A

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)

Meta Mutation Damage Score

0.1015

Coding Region Coverage

1x: 99.4%
3x: 98.7%
10x: 97.2%
20x: 95.1%

Validation Efficiency

97% (73/75)

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210408I21Rik	A	G	13: 77,303,314	E839G	possibly damaging	Het
2410141K09Rik	T	C	13: 66,431,663	R254G	probably benign	Het
4932438A13Rik	T	A	3: 36,917,660	F514Y	probably benign	Het
Adgrf3	T	A	5: 30,197,306	T575S	probably damaging	Het
Akap9	T	A	5: 3,971,926	C1158S	probably benign	Het
Arhgap39	A	G	15: 76,726,633	F926L	probably damaging	Het
BC035947	G	T	1: 78,497,930	T655K	probably benign	Het
Bcas1	T	C	2: 170,406,810	T64A	probably benign	Het
Brca2	A	G	5: 150,540,904	K1378E	probably benign	Het
Card6	A	T	15: 5,100,953	N320K	probably damaging	Het
Ccdc3	A	T	2: 5,138,060	I43F	probably damaging	Het
Cd200r1	T	C	16: 44,790,164	S212P	probably damaging	Het
Cdh8	T	C	8: 99,033,222	I632V	probably benign	Het
Col25a1	A	G	3: 130,564,154	E477G	probably damaging	Het
Cpne5	A	T	17: 29,184,017	C215S	possibly damaging	Het
Crim1	T	A	17: 78,374,083	S989T	possibly damaging	Het
Dnhd1	G	A	7: 105,703,209	R2523Q	probably damaging	Het
Dync1h1	T	A	12: 110,616,404	N340K	probably benign	Het
Eif4e2	G	A	1: 87,226,238		probably null	Het
Ephb6	G	T	6: 41,619,704	R895L	possibly damaging	Het
Esrrg	T	A	1: 188,150,198	H217Q	probably benign	Het
Fgl1	T	A	8: 41,200,557	K100*	probably null	Het
Flt4	T	C	11: 49,630,603	V450A	probably benign	Het
G6pc2	A	T	2: 69,220,784	I74L	probably benign	Het
Gabrr1	T	C	4: 33,161,684	M336T	probably damaging	Het
Gli1	T	A	10: 127,337,436	T118S	probably benign	Het
Gm5435	A	T	12: 82,496,026		noncoding transcript	Het
Got1l1	A	G	8: 27,198,059	L314P	probably damaging	Het
Hk3	T	A	13: 55,006,813	I740F	probably damaging	Het
Htr7	C	A	19: 35,969,871	A248S	probably damaging	Het
Il16	T	A	7: 83,648,728	N431I	probably benign	Het
Lax1	G	A	1: 133,680,176	P276S	probably damaging	Het
Lrp2	A	T	2: 69,511,061	V925E	possibly damaging	Het
Lrp3	T	A	7: 35,203,485	T479S	possibly damaging	Het
Metrn	G	A	17: 25,795,217	R212C	probably damaging	Het
Mlip	A	C	9: 77,347,693		probably null	Het
Mmp24	C	T	2: 155,799,777	T175I	probably damaging	Het
N6amt1	A	T	16: 87,354,335	D28V	probably damaging	Het
Olfr1289	G	A	2: 111,484,143	G238R	probably damaging	Het
Olfr215	T	C	6: 116,582,929	T6A	probably benign	Het
Olfr380	A	T	11: 73,453,851	Y120*	probably null	Het
Olfr472	A	G	7: 107,902,912	H65R	probably damaging	Het
Olfr490	G	T	7: 108,286,742	A128E	probably damaging	Het
Olfr870	T	A	9: 20,170,969	I201F	possibly damaging	Het
Pcdh17	T	A	14: 84,532,993	N970K	probably damaging	Het
Pdzrn3	T	C	6: 101,151,428	Y759C	probably damaging	Het
Pkd2l2	T	C	18: 34,425,237	L323P	probably damaging	Het
Psg21	G	T	7: 18,652,258		probably benign	Het
Rest	T	C	5: 77,281,726	V664A	probably benign	Het
Sco2	G	A	15: 89,371,972	R160*	probably null	Het
Sfswap	T	A	5: 129,514,818	S300T	probably damaging	Het
Slc5a10	A	T	11: 61,678,566	M329K	probably benign	Het
Slco1a5	G	A	6: 142,236,307	P564S	probably damaging	Het
Stk38	A	G	17: 28,982,129	F191S	probably damaging	Het
Svep1	T	A	4: 58,072,826	Y2161F	possibly damaging	Het
Tada2a	G	A	11: 84,079,602	T441M	possibly damaging	Het
Tg	T	A	15: 66,688,889	N1033K	probably benign	Het
Thoc3	A	T	13: 54,467,873	I126N	probably damaging	Het
Tnc	T	C	4: 64,007,730		probably null	Het
Tnc	A	T	4: 64,008,795	D831E	possibly damaging	Het
Uhmk1	A	T	1: 170,211,218	V100E	probably damaging	Het
Usp43	G	A	11: 67,921,916		probably benign	Het
Vmn2r90	A	T	17: 17,713,450	Y424F	probably benign	Het
Vps33a	C	T	5: 123,547,001		probably null	Het
Xirp2	A	T	2: 67,482,298	K37I	probably damaging	Het
Zfp106	A	T	2: 120,533,507		probably null	Het
Zfp748	A	T	13: 67,542,528	C204*	probably null	Het

Other mutations in Igsf9b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00419:Igsf9b	APN	9	27319655	missense	probably damaging	1.00
IGL01013:Igsf9b	APN	9	27334304	missense	probably damaging	1.00
IGL01960:Igsf9b	APN	9	27328606	missense	possibly damaging	0.93
IGL02398:Igsf9b	APN	9	27333130	missense	possibly damaging	0.54
IGL03007:Igsf9b	APN	9	27333082	missense	probably damaging	0.98
G1Funyon:Igsf9b	UTSW	9	27334739	utr 3 prime	probably benign
IGL03014:Igsf9b	UTSW	9	27322636	missense	probably benign	0.00
R0127:Igsf9b	UTSW	9	27334385	missense	possibly damaging	0.65
R0376:Igsf9b	UTSW	9	27334582	missense	probably benign	0.01
R0520:Igsf9b	UTSW	9	27323250	missense	probably benign	0.00
R0534:Igsf9b	UTSW	9	27333062	splice site	probably null
R0613:Igsf9b	UTSW	9	27326920	missense	probably damaging	1.00
R0718:Igsf9b	UTSW	9	27323361	critical splice donor site	probably null
R0828:Igsf9b	UTSW	9	27319605	nonsense	probably null
R0879:Igsf9b	UTSW	9	27333742	missense	probably damaging	1.00
R0882:Igsf9b	UTSW	9	27319316	missense	probably damaging	0.98
R0987:Igsf9b	UTSW	9	27332553	splice site	probably null
R1162:Igsf9b	UTSW	9	27326889	missense	probably benign
R1758:Igsf9b	UTSW	9	27334252	missense	possibly damaging	0.50
R1760:Igsf9b	UTSW	9	27317827	missense	possibly damaging	0.82
R1819:Igsf9b	UTSW	9	27311593	missense	probably damaging	0.98
R1823:Igsf9b	UTSW	9	27331732	missense	probably damaging	0.96
R1982:Igsf9b	UTSW	9	27322239	missense	possibly damaging	0.82
R2150:Igsf9b	UTSW	9	27334337	missense	probably damaging	1.00
R2228:Igsf9b	UTSW	9	27333496	missense	probably damaging	1.00
R2229:Igsf9b	UTSW	9	27333496	missense	probably damaging	1.00
R2250:Igsf9b	UTSW	9	27309478	missense	possibly damaging	0.95
R2872:Igsf9b	UTSW	9	27322223	missense	probably benign	0.11
R2872:Igsf9b	UTSW	9	27322223	missense	probably benign	0.11
R3415:Igsf9b	UTSW	9	27309478	missense	possibly damaging	0.95
R3416:Igsf9b	UTSW	9	27309478	missense	possibly damaging	0.95
R3417:Igsf9b	UTSW	9	27309478	missense	possibly damaging	0.95
R3427:Igsf9b	UTSW	9	27334577	missense	probably damaging	0.99
R4356:Igsf9b	UTSW	9	27309478	missense	possibly damaging	0.95
R4357:Igsf9b	UTSW	9	27309478	missense	possibly damaging	0.95
R4358:Igsf9b	UTSW	9	27309478	missense	possibly damaging	0.95
R4359:Igsf9b	UTSW	9	27309478	missense	possibly damaging	0.95
R4379:Igsf9b	UTSW	9	27309478	missense	possibly damaging	0.95
R4416:Igsf9b	UTSW	9	27322917	missense	probably damaging	1.00
R4445:Igsf9b	UTSW	9	27334252	missense	probably benign	0.13
R4446:Igsf9b	UTSW	9	27334252	missense	probably benign	0.13
R4787:Igsf9b	UTSW	9	27317456	missense	probably benign	0.26
R4887:Igsf9b	UTSW	9	27322650	missense	probably benign	0.45
R5085:Igsf9b	UTSW	9	27317437	missense	probably benign	0.03
R5360:Igsf9b	UTSW	9	27311672	missense	probably damaging	0.98
R5417:Igsf9b	UTSW	9	27334276	small insertion	probably benign
R5738:Igsf9b	UTSW	9	27328530	missense	probably damaging	0.98
R5869:Igsf9b	UTSW	9	27323235	missense	probably benign	0.44
R6304:Igsf9b	UTSW	9	27342575	missense	probably benign	0.19
R6359:Igsf9b	UTSW	9	27309599	missense	probably benign	0.25
R6367:Igsf9b	UTSW	9	27309525	nonsense	probably null
R6556:Igsf9b	UTSW	9	27329555	missense	probably damaging	1.00
R7058:Igsf9b	UTSW	9	27322854	missense	probably damaging	0.99
R7165:Igsf9b	UTSW	9	27334240	missense	probably benign
R7180:Igsf9b	UTSW	9	27322668	missense	possibly damaging	0.95
R7212:Igsf9b	UTSW	9	27331696	missense	probably damaging	0.98
R7461:Igsf9b	UTSW	9	27334122	missense	probably benign	0.10
R7605:Igsf9b	UTSW	9	27323312	missense	probably damaging	0.98
R7609:Igsf9b	UTSW	9	27345890	missense	probably benign
R7613:Igsf9b	UTSW	9	27334122	missense	probably benign	0.10
R8072:Igsf9b	UTSW	9	27317364	missense	possibly damaging	0.94
R8163:Igsf9b	UTSW	9	27322611	splice site	probably null
R8301:Igsf9b	UTSW	9	27334739	utr 3 prime	probably benign
R8546:Igsf9b	UTSW	9	27333130	missense	possibly damaging	0.54
R8553:Igsf9b	UTSW	9	27333443	missense	probably damaging	0.96
R9438:Igsf9b	UTSW	9	27332543	missense	probably benign	0.03
R9585:Igsf9b	UTSW	9	27322236	missense	probably damaging	1.00
R9720:Igsf9b	UTSW	9	27309514	missense	probably damaging	0.99
X0013:Igsf9b	UTSW	9	27331725	missense	possibly damaging	0.89
X0025:Igsf9b	UTSW	9	27309461	missense	probably damaging	1.00
X0028:Igsf9b	UTSW	9	27334372	missense	probably damaging	1.00
Z1176:Igsf9b	UTSW	9	27317353	critical splice acceptor site	probably null
Z1177:Igsf9b	UTSW	9	27334292	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACTAGCCTAAGCAGTGGATGG -3'
(R):5'- CACCCTAGGATAGCAAAGGATG -3'

Sequencing Primer
(F):5'- TGATACATCTCGGTACCC -3'
(R):5'- CAGATGGGATGACCTGCGTG -3'

Posted On

2017-12-01