Mutagenetix > Incidental Mutation

Incidental Mutation 'R5643:Muc5ac'

501286

Institutional Source

Beutler Lab

Gene Symbol

Muc5ac

Ensembl Gene

ENSMUSG00000037974

Gene Name

mucin 5, subtypes A and C, tracheobronchial/gastric

Synonyms

MGM, 2210005L13Rik

MMRRC Submission

043291-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5643 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

141788972-141819231 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to C at 141793715 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000122353 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041924] [ENSMUST00000155534] [ENSMUST00000163321]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000041924

SMART Domains

Protein: ENSMUSP00000039699
Gene: ENSMUSG00000037974

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
VWD	69	226	4.19e-30	SMART
C8	258	334	1.34e-11	SMART
Pfam:TIL	337	393	1.6e-14	PFAM
VWC	395	462	8.6e-18	SMART
VWD	421	585	1.55e-33	SMART
C8	622	696	8.42e-36	SMART
Pfam:TIL	702	759	6.1e-9	PFAM
VWC	761	825	6.75e-1	SMART
VWC	863	905	4.06e-1	SMART
VWD	890	1050	1.51e-45	SMART
C8	1086	1160	2.78e-36	SMART
low complexity region	1315	1330	N/A	INTRINSIC
low complexity region	1333	1366	N/A	INTRINSIC
low complexity region	1371	1387	N/A	INTRINSIC
Pfam:Mucin2_WxxW	1394	1482	2.3e-25	PFAM
low complexity region	1521	1532	N/A	INTRINSIC
low complexity region	1536	1563	N/A	INTRINSIC
low complexity region	1578	1595	N/A	INTRINSIC
Pfam:Mucin2_WxxW	1604	1692	2.2e-27	PFAM
Pfam:Mucin2_WxxW	1765	1857	8.6e-27	PFAM
low complexity region	1875	1895	N/A	INTRINSIC
low complexity region	1949	1968	N/A	INTRINSIC
VWD	2030	2199	4.17e-48	SMART
C8	2242	2311	3.95e-9	SMART
VWC	2376	2439	1.04e-11	SMART
VWC	2479	2543	9.31e-5	SMART
CT	2625	2711	3.43e-32	SMART
low complexity region	2720	2733	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000155534

SMART Domains

Protein: ENSMUSP00000122353
Gene: ENSMUSG00000037974

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
VWD	69	226	4.19e-30	SMART
C8	258	334	1.34e-11	SMART
Pfam:TIL	337	393	9.6e-15	PFAM
VWC	395	437	3.54e-1	SMART
VWD	422	586	2.35e-33	SMART
C8	623	697	8.42e-36	SMART
Pfam:TIL	703	760	3.6e-9	PFAM
VWC	762	826	6.75e-1	SMART
VWC	864	906	4.06e-1	SMART
VWD	891	1051	1.51e-45	SMART
C8	1087	1161	2.78e-36	SMART
low complexity region	1316	1331	N/A	INTRINSIC
low complexity region	1334	1367	N/A	INTRINSIC
low complexity region	1372	1388	N/A	INTRINSIC
Pfam:Mucin2_WxxW	1395	1483	1.3e-25	PFAM
low complexity region	1522	1533	N/A	INTRINSIC
low complexity region	1537	1564	N/A	INTRINSIC
low complexity region	1579	1596	N/A	INTRINSIC
Pfam:Mucin2_WxxW	1605	1693	1.3e-27	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000163321

SMART Domains

Protein: ENSMUSP00000131681
Gene: ENSMUSG00000037974

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
VWD	69	226	4.19e-30	SMART
C8	258	334	1.34e-11	SMART
Pfam:TIL	337	393	7.9e-15	PFAM
VWC	395	462	8.6e-18	SMART
VWD	421	585	1.55e-33	SMART
C8	622	696	8.42e-36	SMART
Pfam:TIL	702	759	1.9e-9	PFAM
VWC	761	825	6.75e-1	SMART
VWC	863	905	4.06e-1	SMART
VWD	890	1050	1.51e-45	SMART
C8	1086	1160	2.78e-36	SMART
low complexity region	1315	1330	N/A	INTRINSIC
low complexity region	1333	1366	N/A	INTRINSIC
low complexity region	1371	1387	N/A	INTRINSIC
Pfam:Mucin2_WxxW	1394	1481	1.1e-23	PFAM
low complexity region	1521	1532	N/A	INTRINSIC
low complexity region	1536	1563	N/A	INTRINSIC
low complexity region	1578	1595	N/A	INTRINSIC
Pfam:Mucin2_WxxW	1604	1691	1.1e-25	PFAM
Pfam:Mucin2_WxxW	1765	1856	6.3e-24	PFAM
low complexity region	1875	1895	N/A	INTRINSIC
low complexity region	1949	1968	N/A	INTRINSIC
VWD	2030	2199	4.17e-48	SMART
C8	2242	2311	3.95e-9	SMART
VWC	2376	2439	1.04e-11	SMART
VWC	2479	2543	9.31e-5	SMART
CT	2625	2711	3.43e-32	SMART
low complexity region	2720	2733	N/A	INTRINSIC

Meta Mutation Damage Score

0.9484

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.2%
20x: 95.2%

Validation Efficiency

94% (110/117)

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to T. muris infection with persistent worm burden, goblet cell hyperplasia, and increased serum IFN-gamma despite a normal TH2-type immune response. A portion of mice show corneal opacity and poor tear quality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 102 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ahnak	A	G	19: 9,010,657	K3102E	possibly damaging	Het
Akap13	T	C	7: 75,702,154		probably null	Het
Akp3	A	T	1: 87,127,763	T511S	unknown	Het
Alkal2	T	A	12: 30,884,890	L36Q	probably damaging	Het
Arhgef17	A	T	7: 100,880,011	V523E	probably damaging	Het
Asah1	G	T	8: 41,360,295	T27K	possibly damaging	Het
Bag2	A	G	1: 33,746,953	V96A	probably damaging	Het
Bicd1	C	T	6: 149,520,403	A874V	probably damaging	Het
C4b	T	C	17: 34,742,417	I189M	probably benign	Het
Calcr	A	G	6: 3,708,538	I216T	probably damaging	Het
Cdk5rap2	T	A	4: 70,266,733	D1160V	probably damaging	Het
Cep128	A	T	12: 91,348,851	I87K	probably damaging	Het
Cep170b	C	G	12: 112,740,841	H1256Q	probably benign	Het
Chd2	A	T	7: 73,484,484	V705E	probably damaging	Het
Clec12b	T	A	6: 129,379,960	I172L	probably benign	Het
Cobl	A	T	11: 12,306,948		probably benign	Het
Col5a2	T	A	1: 45,390,042	D972V	probably damaging	Het
Csrp1	A	T	1: 135,751,059	N174I	probably damaging	Het
Dnah7a	T	A	1: 53,405,707	H3946L	probably benign	Het
Dnajc21	A	T	15: 10,461,915	D133E	probably benign	Het
Dvl3	T	A	16: 20,526,276	I353N	probably damaging	Het
Elavl3	A	T	9: 22,018,733	S292T	probably benign	Het
Ephb2	T	C	4: 136,771,612	N52S	probably damaging	Het
Gaa	T	A	11: 119,280,535	M671K	possibly damaging	Het
Gabrg3	T	C	7: 56,773,284	D222G	possibly damaging	Het
Gk5	C	T	9: 96,140,656	Q182*	probably null	Het
Gm14403	A	T	2: 177,507,261	H50L	possibly damaging	Het
Gzma	T	C	13: 113,098,260	T66A	probably damaging	Het
Hint2	T	C	4: 43,656,445		probably benign	Het
Hnmt	A	T	2: 24,014,239	W137R	probably damaging	Het
Hoga1	T	C	19: 42,059,963	V90A	probably benign	Het
Idua	A	T	5: 108,680,224		probably benign	Het
Kif1a	A	C	1: 93,055,767	S669R	probably damaging	Het
Klhdc7b	A	T	15: 89,387,659	M915L	possibly damaging	Het
Klhl41	A	G	2: 69,670,471	Y92C	probably damaging	Het
Klrc2	A	T	6: 129,656,457	C186S	probably damaging	Het
Lmo7	A	G	14: 101,929,336		probably benign	Het
Lrriq1	T	C	10: 103,215,440	M484V	probably benign	Het
Lzts1	A	G	8: 69,139,077	S140P	possibly damaging	Het
Mgat5b	T	A	11: 116,973,400	V464E	probably damaging	Het
Mms19	A	T	19: 41,955,866	D298E	possibly damaging	Het
Mycbp2	T	A	14: 103,287,334	K597I	probably damaging	Het
Myo18a	C	A	11: 77,854,687	D1619E	probably benign	Het
Nfx1	T	C	4: 40,984,973	W366R	probably null	Het
Nipbl	C	T	15: 8,358,907	V410I	probably benign	Het
Olfr1037	T	C	2: 86,085,159	N206S	probably damaging	Het
Olfr116	T	A	17: 37,624,432	I68F	probably benign	Het
Olfr1188	T	A	2: 88,559,505	M1K	probably null	Het
Olfr1313	A	T	2: 112,071,668	M305K	probably benign	Het
Olfr1443	A	T	19: 12,680,972	Y288F	probably damaging	Het
Olfr648	T	C	7: 104,179,884	I175V	probably benign	Het
Olfr850	A	T	9: 19,477,557	M231K	probably benign	Het
Otog	A	T	7: 46,287,447	T1527S	probably damaging	Het
P2ry12	A	T	3: 59,218,095	M53K	possibly damaging	Het
Pask	A	G	1: 93,337,343		probably null	Het
Pcca	G	A	14: 122,887,069	C684Y	probably damaging	Het
Pcdhb10	A	G	18: 37,413,166	T432A	possibly damaging	Het
Peak1	T	C	9: 56,258,755	N630D	probably damaging	Het
Plbd2	A	T	5: 120,493,166		probably null	Het
Plekhg5	T	C	4: 152,104,340	V200A	probably benign	Het
Pola2	A	G	19: 5,961,170	V42A	probably benign	Het
Ppfibp2	T	A	7: 107,737,890	W572R	probably damaging	Het
Ppp6r1	C	T	7: 4,633,772	E679K	probably benign	Het
Pramef6	A	T	4: 143,895,767	H339Q	probably damaging	Het
Prdx3	G	A	19: 60,871,525	A70V	probably damaging	Het
Prkd2	T	C	7: 16,843,792	F57L	probably benign	Het
Prodh2	A	G	7: 30,506,746	T324A	possibly damaging	Het
Ptdss1	T	C	13: 66,972,540	F267L	probably damaging	Het
Rai14	T	A	15: 10,593,051	H169L	probably benign	Het
Rere	A	G	4: 150,617,243	H1360R	probably damaging	Het
Rfc3	C	T	5: 151,649,979	V40I	probably benign	Het
Rims1	T	A	1: 22,538,509	T219S	probably damaging	Het
Rnf169	T	C	7: 99,927,131	R289G	possibly damaging	Het
Senp7	T	C	16: 56,184,149		silent	Het
Sfmbt2	A	T	2: 10,568,373	I571F	probably damaging	Het
Slc11a2	C	A	15: 100,403,187	K328N	probably benign	Het
Slc25a10	A	G	11: 120,496,376		probably benign	Het
Slc38a8	T	C	8: 119,480,749	*433W	probably null	Het
Slco1a5	A	C	6: 142,237,594		probably null	Het
Smc6	T	A	12: 11,289,994	N434K	probably benign	Het
Syndig1	A	T	2: 149,899,508	I5F	possibly damaging	Het
Syt5	T	C	7: 4,543,019	Q124R	probably benign	Het
Taok3	A	C	5: 117,206,720	M171L	probably benign	Het
Tbrg1	T	C	9: 37,649,413	D389G	probably benign	Het
Tcaf2	G	A	6: 42,642,773	R107C	possibly damaging	Het
Tex14	C	A	11: 87,535,626	H1159Q	probably damaging	Het
Tmprss11d	T	A	5: 86,326,529	M190L	probably benign	Het
Ttn	T	A	2: 76,938,523	T2856S	probably damaging	Het
Ubr4	T	A	4: 139,444,687	M2997K	probably damaging	Het
Unc5c	C	T	3: 141,678,125	A88V	probably damaging	Het
Use1	T	C	8: 71,367,754		probably benign	Het
Vmn1r43	T	C	6: 89,870,372	N44S	probably damaging	Het
Vmn1r89	T	A	7: 13,220,219	V294D	possibly damaging	Het
Vmn2r11	A	T	5: 109,047,003	V819E	probably damaging	Het
Vmn2r120	T	A	17: 57,524,977	M271L	probably benign	Het
Vmn2r52	T	C	7: 10,171,132	Y260C	probably damaging	Het
Vmn2r67	T	A	7: 85,149,943	R519*	probably null	Het
Vmn2r69	T	A	7: 85,407,196	D578V	probably damaging	Het
Vmn2r85	T	C	10: 130,426,474	Y132C	probably damaging	Het
Wdr74	T	A	19: 8,737,876	V133E	probably damaging	Het
Zfp318	T	A	17: 46,409,244		probably benign	Het
Zfp810	A	T	9: 22,283,171	S74T	probably benign	Het

Other mutations in Muc5ac

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00899:Muc5ac	APN	7	141812703	missense	possibly damaging	0.93
IGL01064:Muc5ac	APN	7	141807473	missense	probably benign	0.12
IGL01155:Muc5ac	APN	7	141806943	splice site	probably benign
IGL01452:Muc5ac	APN	7	141817555	missense	probably benign	0.00
IGL01590:Muc5ac	APN	7	141798893	missense	probably benign	0.02
IGL02104:Muc5ac	APN	7	141811078	missense	probably damaging	0.98
IGL02152:Muc5ac	APN	7	141800177	missense	possibly damaging	0.86
IGL02153:Muc5ac	APN	7	141818800	nonsense	probably null
IGL02178:Muc5ac	APN	7	141805447	splice site	probably benign
IGL02403:Muc5ac	APN	7	141803450	missense	possibly damaging	0.71
IGL02576:Muc5ac	APN	7	141817044	missense	probably benign	0.01
IGL02665:Muc5ac	APN	7	141791086	missense	possibly damaging	0.71
IGL02704:Muc5ac	APN	7	141795263	missense	possibly damaging	0.71
IGL02808:Muc5ac	APN	7	141805775	missense	possibly damaging	0.72
IGL03283:Muc5ac	APN	7	141813781	missense	probably benign	0.34
IGL03384:Muc5ac	APN	7	141812403	missense	possibly damaging	0.71
IGL03046:Muc5ac	UTSW	7	141795213	missense	probably benign	0.27
PIT4515001:Muc5ac	UTSW	7	141807416	missense	probably damaging	0.99
R0092:Muc5ac	UTSW	7	141818630	missense	possibly damaging	0.72
R0145:Muc5ac	UTSW	7	141795275	missense	possibly damaging	0.71
R0147:Muc5ac	UTSW	7	141811039	missense	probably benign	0.08
R0363:Muc5ac	UTSW	7	141800960	missense	probably benign	0.01
R0384:Muc5ac	UTSW	7	141812251	missense	possibly damaging	0.71
R0440:Muc5ac	UTSW	7	141792034	nonsense	probably null
R0583:Muc5ac	UTSW	7	141807608	missense	probably damaging	0.99
R0616:Muc5ac	UTSW	7	141796244	missense	probably benign	0.02
R0682:Muc5ac	UTSW	7	141805669	missense	possibly damaging	0.53
R0685:Muc5ac	UTSW	7	141807709	missense	probably benign	0.03
R0883:Muc5ac	UTSW	7	141796265	missense	possibly damaging	0.71
R0924:Muc5ac	UTSW	7	141807515	missense	possibly damaging	0.68
R1300:Muc5ac	UTSW	7	141816929	missense	possibly damaging	0.73
R1315:Muc5ac	UTSW	7	141807323	missense	probably damaging	0.99
R1354:Muc5ac	UTSW	7	141807377	missense	probably damaging	0.99
R1484:Muc5ac	UTSW	7	141813892	splice site	probably null
R1599:Muc5ac	UTSW	7	141798903	missense	possibly damaging	0.52
R1758:Muc5ac	UTSW	7	141801531	missense	possibly damaging	0.86
R1837:Muc5ac	UTSW	7	141807086	missense	probably benign	0.00
R1911:Muc5ac	UTSW	7	141796304	missense	probably benign	0.18
R1922:Muc5ac	UTSW	7	141793689	missense	probably benign	0.03
R1966:Muc5ac	UTSW	7	141803376	missense	possibly damaging	0.92
R1994:Muc5ac	UTSW	7	141813152	missense	possibly damaging	0.93
R2056:Muc5ac	UTSW	7	141792035	missense	probably benign	0.01
R2126:Muc5ac	UTSW	7	141810742	missense	possibly damaging	0.84
R2170:Muc5ac	UTSW	7	141812347	missense	possibly damaging	0.93
R2258:Muc5ac	UTSW	7	141791008	missense	probably benign	0.41
R2259:Muc5ac	UTSW	7	141791008	missense	probably benign	0.41
R2293:Muc5ac	UTSW	7	141807199	missense	probably damaging	0.99
R2435:Muc5ac	UTSW	7	141818104	missense	possibly damaging	0.53
R2895:Muc5ac	UTSW	7	141791140	missense	possibly damaging	0.92
R2910:Muc5ac	UTSW	7	141807641	missense	probably damaging	0.99
R3154:Muc5ac	UTSW	7	141792736	splice site	probably null
R3762:Muc5ac	UTSW	7	141807475	missense	possibly damaging	0.53
R3791:Muc5ac	UTSW	7	141798501	missense	probably benign	0.32
R3806:Muc5ac	UTSW	7	141813734	missense	possibly damaging	0.91
R3825:Muc5ac	UTSW	7	141814723	missense	possibly damaging	0.92
R3888:Muc5ac	UTSW	7	141791224	missense	possibly damaging	0.51
R3929:Muc5ac	UTSW	7	141802892	missense	probably benign
R3981:Muc5ac	UTSW	7	141813775	missense	possibly damaging	0.86
R4034:Muc5ac	UTSW	7	141799844	critical splice donor site	probably null
R4043:Muc5ac	UTSW	7	141807478	missense	possibly damaging	0.53
R4061:Muc5ac	UTSW	7	141811130	missense	possibly damaging	0.85
R4106:Muc5ac	UTSW	7	141802835	missense	possibly damaging	0.86
R4206:Muc5ac	UTSW	7	141817110	missense	possibly damaging	0.73
R4613:Muc5ac	UTSW	7	141791103	missense	possibly damaging	0.93
R4719:Muc5ac	UTSW	7	141789763	missense	possibly damaging	0.83
R4751:Muc5ac	UTSW	7	141817601	missense	probably benign	0.00
R4789:Muc5ac	UTSW	7	141798882	missense	possibly damaging	0.86
R4928:Muc5ac	UTSW	7	141817902	nonsense	probably null
R4971:Muc5ac	UTSW	7	141816278	missense	possibly damaging	0.68
R4982:Muc5ac	UTSW	7	141809456	intron	probably benign
R5088:Muc5ac	UTSW	7	141796319	missense	possibly damaging	0.53
R5141:Muc5ac	UTSW	7	141814742	missense	possibly damaging	0.72
R5224:Muc5ac	UTSW	7	141793971	missense	probably benign	0.32
R5366:Muc5ac	UTSW	7	141807550	missense	probably benign	0.01
R5497:Muc5ac	UTSW	7	141807643	missense	probably damaging	0.99
R5507:Muc5ac	UTSW	7	141807832	missense	possibly damaging	0.72
R5811:Muc5ac	UTSW	7	141798984	missense	possibly damaging	0.51
R5946:Muc5ac	UTSW	7	141817907	missense	possibly damaging	0.73
R5970:Muc5ac	UTSW	7	141790669	nonsense	probably null
R5977:Muc5ac	UTSW	7	141796367	missense	possibly damaging	0.73
R6051:Muc5ac	UTSW	7	141811857	missense	possibly damaging	0.53
R6126:Muc5ac	UTSW	7	141801232	missense	possibly damaging	0.71
R6159:Muc5ac	UTSW	7	141815586	missense	possibly damaging	0.53
R6256:Muc5ac	UTSW	7	141789795	missense	possibly damaging	0.53
R6283:Muc5ac	UTSW	7	141816864	nonsense	probably null
R6341:Muc5ac	UTSW	7	141801492	missense	probably damaging	0.99
R6356:Muc5ac	UTSW	7	141812679	missense	probably benign	0.05
R6481:Muc5ac	UTSW	7	141809071	intron	probably benign
R6483:Muc5ac	UTSW	7	141802854	missense	probably benign	0.18
R6627:Muc5ac	UTSW	7	141808690	intron	probably benign
R6636:Muc5ac	UTSW	7	141818605	missense	possibly damaging	0.86
R6637:Muc5ac	UTSW	7	141818605	missense	possibly damaging	0.86
R6656:Muc5ac	UTSW	7	141803328	missense	probably damaging	0.98
R6721:Muc5ac	UTSW	7	141798992	missense	possibly damaging	0.71
R6794:Muc5ac	UTSW	7	141809552	intron	probably benign
R6844:Muc5ac	UTSW	7	141809744	intron	probably benign
R6847:Muc5ac	UTSW	7	141809744	intron	probably benign
R6852:Muc5ac	UTSW	7	141816907	missense	probably benign	0.03
R6862:Muc5ac	UTSW	7	141809744	intron	probably benign
R6863:Muc5ac	UTSW	7	141809744	intron	probably benign
R6864:Muc5ac	UTSW	7	141809744	intron	probably benign
R6865:Muc5ac	UTSW	7	141809744	intron	probably benign
R6874:Muc5ac	UTSW	7	141809744	intron	probably benign
R6875:Muc5ac	UTSW	7	141809744	intron	probably benign
R6876:Muc5ac	UTSW	7	141809744	intron	probably benign
R6877:Muc5ac	UTSW	7	141809744	intron	probably benign
R6889:Muc5ac	UTSW	7	141809744	intron	probably benign
R6920:Muc5ac	UTSW	7	141793298	missense	possibly damaging	0.86
R6998:Muc5ac	UTSW	7	141818714	missense	possibly damaging	0.92
R7017:Muc5ac	UTSW	7	141809687	intron	probably benign
R7091:Muc5ac	UTSW	7	141809687	intron	probably benign
R7092:Muc5ac	UTSW	7	141809648	intron	probably benign
R7092:Muc5ac	UTSW	7	141809687	intron	probably benign
R7110:Muc5ac	UTSW	7	141799822	missense	possibly damaging	0.95
R7117:Muc5ac	UTSW	7	141813822	nonsense	probably null
R7238:Muc5ac	UTSW	7	141809517	missense	unknown
R7238:Muc5ac	UTSW	7	141809687	intron	probably benign
R7396:Muc5ac	UTSW	7	141808415	missense	unknown
R7456:Muc5ac	UTSW	7	141793167	missense	probably benign	0.32
R7477:Muc5ac	UTSW	7	141816282	missense	possibly damaging	0.72
R7530:Muc5ac	UTSW	7	141813799	missense	possibly damaging	0.51
R7545:Muc5ac	UTSW	7	141808668	missense	unknown
R7604:Muc5ac	UTSW	7	141809709	missense	unknown
R7635:Muc5ac	UTSW	7	141805676	missense	probably damaging	0.98
R7635:Muc5ac	UTSW	7	141805753	missense	possibly damaging	0.53
R7650:Muc5ac	UTSW	7	141809422	missense	unknown
R7651:Muc5ac	UTSW	7	141796254	missense	possibly damaging	0.92
R7685:Muc5ac	UTSW	7	141809383	missense	unknown
R7720:Muc5ac	UTSW	7	141809303	missense	unknown
R7749:Muc5ac	UTSW	7	141809303	missense	unknown
R7750:Muc5ac	UTSW	7	141809303	missense	unknown
R7751:Muc5ac	UTSW	7	141809303	missense	unknown
R7754:Muc5ac	UTSW	7	141809303	missense	unknown
R7798:Muc5ac	UTSW	7	141794041	critical splice donor site	probably null
R7835:Muc5ac	UTSW	7	141809303	missense	unknown
R7837:Muc5ac	UTSW	7	141815963	missense	possibly damaging	0.53
R7858:Muc5ac	UTSW	7	141803429	missense	possibly damaging	0.51
R7866:Muc5ac	UTSW	7	141795852	missense	probably benign	0.00
R7874:Muc5ac	UTSW	7	141809303	missense	unknown
R7876:Muc5ac	UTSW	7	141809303	missense	unknown
R7877:Muc5ac	UTSW	7	141809303	missense	unknown
R7881:Muc5ac	UTSW	7	141809303	missense	unknown
R7884:Muc5ac	UTSW	7	141809303	missense	unknown
R7921:Muc5ac	UTSW	7	141809687	intron	probably benign
R7976:Muc5ac	UTSW	7	141809791	missense	unknown
R8104:Muc5ac	UTSW	7	141804783	missense	possibly damaging	0.96
R8177:Muc5ac	UTSW	7	141807331	missense	probably damaging	1.00
R8214:Muc5ac	UTSW	7	141802948	missense	possibly damaging	0.53
R8292:Muc5ac	UTSW	7	141809263	missense	unknown
R8386:Muc5ac	UTSW	7	141807634	missense	possibly damaging	0.93
R8400:Muc5ac	UTSW	7	141810476	missense	probably damaging	0.99
R8504:Muc5ac	UTSW	7	141807155	missense	probably damaging	1.00
R8709:Muc5ac	UTSW	7	141816926	missense	possibly damaging	0.96
R8725:Muc5ac	UTSW	7	141809744	intron	probably benign
R8727:Muc5ac	UTSW	7	141809744	intron	probably benign
R8754:Muc5ac	UTSW	7	141800271	missense	possibly damaging	0.85
R8769:Muc5ac	UTSW	7	141818872	missense	probably damaging	1.00
R8933:Muc5ac	UTSW	7	141789756	missense	possibly damaging	0.59
R8939:Muc5ac	UTSW	7	141793354	missense	probably damaging	0.98
R9049:Muc5ac	UTSW	7	141808975	missense	unknown
R9124:Muc5ac	UTSW	7	141809792	missense	unknown
R9131:Muc5ac	UTSW	7	141809792	missense	unknown
R9132:Muc5ac	UTSW	7	141809792	missense	unknown
R9135:Muc5ac	UTSW	7	141798481	missense	probably damaging	0.99
R9156:Muc5ac	UTSW	7	141809792	missense	unknown
R9157:Muc5ac	UTSW	7	141809792	missense	unknown
R9159:Muc5ac	UTSW	7	141809792	missense	unknown
R9160:Muc5ac	UTSW	7	141809792	missense	unknown
R9161:Muc5ac	UTSW	7	141799289	missense	possibly damaging	0.53
R9175:Muc5ac	UTSW	7	141812356	missense	possibly damaging	0.92
R9183:Muc5ac	UTSW	7	141798900	missense	possibly damaging	0.71
R9218:Muc5ac	UTSW	7	141807361	missense	probably damaging	0.99
R9219:Muc5ac	UTSW	7	141817063	nonsense	probably null
R9239:Muc5ac	UTSW	7	141800217	missense	probably damaging	0.99
R9246:Muc5ac	UTSW	7	141810478	missense	probably benign	0.11
R9287:Muc5ac	UTSW	7	141807889	missense	probably damaging	0.99
R9320:Muc5ac	UTSW	7	141815518	missense	probably benign	0.01
R9327:Muc5ac	UTSW	7	141811692	missense	possibly damaging	0.86
R9428:Muc5ac	UTSW	7	141808822	missense	unknown
R9430:Muc5ac	UTSW	7	141808832	missense	unknown
R9454:Muc5ac	UTSW	7	141808694	missense	unknown
R9483:Muc5ac	UTSW	7	141811728	nonsense	probably null
R9581:Muc5ac	UTSW	7	141810062	missense	unknown
R9610:Muc5ac	UTSW	7	141796341	missense	possibly damaging	0.86
R9642:Muc5ac	UTSW	7	141795864	missense	possibly damaging	0.71
R9684:Muc5ac	UTSW	7	141811061	missense	probably benign	0.41
R9760:Muc5ac	UTSW	7	141807248	missense	probably benign	0.05
R9778:Muc5ac	UTSW	7	141795284	nonsense	probably null
X0060:Muc5ac	UTSW	7	141803333	missense	possibly damaging	0.71
Z1088:Muc5ac	UTSW	7	141809744	intron	probably benign
Z1088:Muc5ac	UTSW	7	141811692	missense	possibly damaging	0.86
Z1177:Muc5ac	UTSW	7	141809224	missense	unknown
Z1177:Muc5ac	UTSW	7	141818040	missense	probably benign	0.33

Predicted Primers

PCR Primer
(F):5'- AGAGATCCCTATGACCCTGG -3'
(R):5'- CTCCAGAACATGTGCTACAGG -3'

Sequencing Primer
(F):5'- GGCCCAAAGTGTCTCTGTACTG -3'
(R):5'- ACATGTGCTACAGGTAGGAAG -3'

Posted On

2017-12-01