Incidental Mutation 'R5689:Pde4dip'
ID 501293
Institutional Source Beutler Lab
Gene Symbol Pde4dip
Ensembl Gene ENSMUSG00000038170
Gene Name phosphodiesterase 4D interacting protein (myomegalin)
Synonyms D130016K21Rik, Usmg4, 4732458A06Rik, D3Bwg1078e, 9430063L05Rik
MMRRC Submission 043322-MU
Accession Numbers

Genbank:NM_001039376.2, NM_001110163.1, NM_178080.4, NM_177145.3; MGI: 1891434; Ensembl: ENSMUST00000045243, ENSMUST00000090750, ENSMUST00000107038, ENSMUST00000163531, ENSMUST00000168438
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R5689 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 97689824-97888707 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 97692367 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Stop codon at position 2384 (L2384*)
Ref Sequence ENSEMBL: ENSMUSP00000131170 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090750] [ENSMUST00000168438]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000090750
AA Change: L2435*
SMART Domains Protein: ENSMUSP00000088254
Gene: ENSMUSG00000038170
AA Change: L2435*

DomainStartEndE-ValueType
low complexity region 10 40 N/A INTRINSIC
low complexity region 45 57 N/A INTRINSIC
Pfam:Cnn_1N 124 196 3.2e-26 PFAM
low complexity region 204 219 N/A INTRINSIC
coiled coil region 282 325 N/A INTRINSIC
internal_repeat_1 397 438 4.03e-5 PROSPERO
low complexity region 567 578 N/A INTRINSIC
internal_repeat_2 617 667 6.59e-5 PROSPERO
internal_repeat_1 620 661 4.03e-5 PROSPERO
coiled coil region 866 942 N/A INTRINSIC
low complexity region 1038 1056 N/A INTRINSIC
low complexity region 1067 1082 N/A INTRINSIC
coiled coil region 1118 1163 N/A INTRINSIC
coiled coil region 1336 1363 N/A INTRINSIC
low complexity region 1403 1420 N/A INTRINSIC
coiled coil region 1470 1508 N/A INTRINSIC
internal_repeat_2 1597 1644 6.59e-5 PROSPERO
DUF1220 1680 1747 1.17e-17 SMART
low complexity region 1758 1780 N/A INTRINSIC
low complexity region 1836 1851 N/A INTRINSIC
low complexity region 1860 1874 N/A INTRINSIC
low complexity region 1940 1951 N/A INTRINSIC
coiled coil region 1962 2138 N/A INTRINSIC
coiled coil region 2162 2197 N/A INTRINSIC
coiled coil region 2387 2431 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000168438
AA Change: L2384*
SMART Domains Protein: ENSMUSP00000131170
Gene: ENSMUSG00000038170
AA Change: L2384*

DomainStartEndE-ValueType
low complexity region 10 40 N/A INTRINSIC
low complexity region 45 57 N/A INTRINSIC
Pfam:Microtub_assoc 124 198 1.4e-31 PFAM
low complexity region 204 219 N/A INTRINSIC
coiled coil region 282 325 N/A INTRINSIC
internal_repeat_1 397 438 3.56e-5 PROSPERO
low complexity region 567 578 N/A INTRINSIC
internal_repeat_2 617 667 5.83e-5 PROSPERO
internal_repeat_1 620 661 3.56e-5 PROSPERO
coiled coil region 866 942 N/A INTRINSIC
low complexity region 1038 1056 N/A INTRINSIC
low complexity region 1067 1082 N/A INTRINSIC
coiled coil region 1118 1163 N/A INTRINSIC
coiled coil region 1336 1363 N/A INTRINSIC
low complexity region 1403 1420 N/A INTRINSIC
coiled coil region 1470 1508 N/A INTRINSIC
internal_repeat_2 1597 1644 5.83e-5 PROSPERO
DUF1220 1680 1747 1.17e-17 SMART
low complexity region 1758 1769 N/A INTRINSIC
low complexity region 1785 1800 N/A INTRINSIC
low complexity region 1809 1823 N/A INTRINSIC
low complexity region 1889 1900 N/A INTRINSIC
coiled coil region 1911 2087 N/A INTRINSIC
coiled coil region 2111 2146 N/A INTRINSIC
coiled coil region 2336 2380 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184178
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197791
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200063
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 95% (63/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene serves to anchor phosphodiesterase 4D to the Golgi/centrosome region of the cell. Defects in this gene may be a cause of myeloproliferative disorder (MBD) associated with eosinophilia. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit partial (in utero or perinatal) lethality, hyperactivity, and increased vertical activity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy7 G T 8: 88,324,784 C844F probably benign Het
Afdn T C 17: 13,855,359 V945A probably damaging Het
Aimp2 T C 5: 143,906,571 D67G possibly damaging Het
Aqp7 G A 4: 41,035,510 T115I probably benign Het
Atp11b G T 3: 35,834,352 V924F possibly damaging Het
Atp8b1 C T 18: 64,564,537 R412H probably damaging Het
Cfb T A 17: 34,861,794 T76S probably benign Het
Cmpk2 A T 12: 26,469,767 H139L probably benign Het
Cypt4 T C 9: 24,625,246 S11P possibly damaging Het
Dbx1 A G 7: 49,632,771 F229L probably damaging Het
Dnah6 T A 6: 73,021,227 M4071L probably benign Het
Dnah7a A G 1: 53,405,698 V3949A possibly damaging Het
Dnajc25 A G 4: 59,017,716 E6G probably damaging Het
Dync2h1 C A 9: 7,169,689 V263F probably damaging Het
Eno4 T A 19: 58,970,656 D403E probably benign Het
Evi5l C T 8: 4,205,460 Q542* probably null Het
Fam135a A G 1: 24,029,053 S12P probably benign Het
Fam198a T C 9: 121,965,688 F303L probably damaging Het
Flnc G A 6: 29,441,592 A458T probably benign Het
Fnip1 T C 11: 54,502,289 V517A probably damaging Het
Galc G T 12: 98,212,986 H361N possibly damaging Het
Gcnt1 T A 19: 17,329,404 D319V probably damaging Het
Gm26996 T C 6: 130,578,295 noncoding transcript Het
Gm5321 A T 7: 6,019,269 noncoding transcript Het
Grin3b T C 10: 79,974,631 L657P probably damaging Het
Gstm5 T C 3: 107,896,665 F54S probably damaging Het
Ilk C A 7: 105,741,650 L267I probably benign Het
Lifr A G 15: 7,184,804 Y713C probably damaging Het
Lnx2 A T 5: 147,029,151 V386E probably damaging Het
Lrch1 T C 14: 74,786,324 E587G probably damaging Het
Olfr1512 C T 14: 52,372,757 V99M possibly damaging Het
Osgin1 A G 8: 119,444,989 *173W probably null Het
Pcdhga7 C A 18: 37,716,683 P581H probably damaging Het
Phf12 T A 11: 78,023,725 N115K probably damaging Het
Pmel A G 10: 128,716,301 T335A probably damaging Het
Polr3e C A 7: 120,940,689 T579K possibly damaging Het
Ptprc A G 1: 138,117,777 V164A probably benign Het
Rapsn T C 2: 91,035,924 F43S probably damaging Het
Rarb T A 14: 16,434,177 I334F probably damaging Het
Rev3l T C 10: 39,794,958 Y167H probably damaging Het
Rnf146 T C 10: 29,347,804 T29A probably benign Het
Rsf1 GC GCGGCGGCGCC 7: 97,579,934 probably benign Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Slc5a10 C T 11: 61,707,884 M223I probably benign Het
Slc7a11 C G 3: 50,372,331 V494L probably benign Het
Slitrk6 C T 14: 110,752,126 E50K probably benign Het
Smg8 A G 11: 87,085,123 F544S probably damaging Het
Tnpo3 T C 6: 29,571,064 M444V possibly damaging Het
Trav7d-4 G A 14: 52,770,194 R48H probably damaging Het
Trim50 A T 5: 135,353,662 T123S probably damaging Het
Trpc4ap C G 2: 155,671,035 probably null Het
Ttn T A 2: 76,788,276 R14475S probably damaging Het
Uts2 A T 4: 150,999,108 T59S possibly damaging Het
Vmn1r52 T C 6: 90,179,250 S179P possibly damaging Het
Vmn2r116 A G 17: 23,397,719 H537R probably benign Het
Vps16 C T 2: 130,439,091 Q226* probably null Het
Zfhx2 T C 14: 55,073,903 T445A possibly damaging Het
Zfp638 T C 6: 83,929,072 V73A probably damaging Het
Other mutations in Pde4dip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Pde4dip APN 3 97767277 missense probably benign 0.00
IGL00543:Pde4dip APN 3 97757624 missense possibly damaging 0.91
IGL00979:Pde4dip APN 3 97747758 splice site probably benign
IGL01483:Pde4dip APN 3 97754149 missense probably damaging 1.00
IGL02122:Pde4dip APN 3 97767421 missense probably damaging 1.00
IGL02398:Pde4dip APN 3 97766781 missense probably benign
IGL02814:Pde4dip APN 3 97767100 missense probably damaging 1.00
IGL02826:Pde4dip APN 3 97767087 missense probably damaging 1.00
D3080:Pde4dip UTSW 3 97766830 missense probably damaging 1.00
R0077:Pde4dip UTSW 3 97753126 nonsense probably null
R0096:Pde4dip UTSW 3 97767467 missense probably damaging 0.99
R0277:Pde4dip UTSW 3 97843712 missense probably benign 0.01
R0304:Pde4dip UTSW 3 97843712 missense probably benign 0.01
R0616:Pde4dip UTSW 3 97747533 missense probably benign 0.09
R0676:Pde4dip UTSW 3 97717097 splice site probably benign
R1166:Pde4dip UTSW 3 97713196 missense possibly damaging 0.94
R1376:Pde4dip UTSW 3 97743217 missense probably damaging 0.99
R1376:Pde4dip UTSW 3 97743217 missense probably damaging 0.99
R1452:Pde4dip UTSW 3 97724102 missense probably damaging 1.00
R1550:Pde4dip UTSW 3 97719704 missense probably damaging 1.00
R1700:Pde4dip UTSW 3 97703323 missense probably benign 0.00
R1704:Pde4dip UTSW 3 97754260 missense probably benign 0.28
R1769:Pde4dip UTSW 3 97695930 missense probably benign 0.00
R1934:Pde4dip UTSW 3 97692691 missense possibly damaging 0.74
R1980:Pde4dip UTSW 3 97756996 missense possibly damaging 0.93
R2088:Pde4dip UTSW 3 97754433 missense probably null 1.00
R2143:Pde4dip UTSW 3 97888519 missense possibly damaging 0.86
R2149:Pde4dip UTSW 3 97792836 missense possibly damaging 0.64
R2156:Pde4dip UTSW 3 97724218 missense probably damaging 0.98
R2158:Pde4dip UTSW 3 97757621 missense probably benign 0.15
R2240:Pde4dip UTSW 3 97724164 missense probably benign 0.00
R2249:Pde4dip UTSW 3 97793525 missense probably damaging 1.00
R2256:Pde4dip UTSW 3 97718184 missense probably damaging 1.00
R2680:Pde4dip UTSW 3 97701617 missense possibly damaging 0.92
R2921:Pde4dip UTSW 3 97719569 missense probably benign
R3407:Pde4dip UTSW 3 97754468 missense probably damaging 1.00
R3736:Pde4dip UTSW 3 97724111 missense probably damaging 1.00
R3787:Pde4dip UTSW 3 97715552 missense possibly damaging 0.80
R3883:Pde4dip UTSW 3 97713188 missense probably damaging 1.00
R4437:Pde4dip UTSW 3 97766569 missense possibly damaging 0.52
R4528:Pde4dip UTSW 3 97717022 missense probably damaging 1.00
R4576:Pde4dip UTSW 3 97754249 missense probably damaging 1.00
R4600:Pde4dip UTSW 3 97695944 missense probably damaging 0.98
R4653:Pde4dip UTSW 3 97767338 missense probably damaging 0.99
R4678:Pde4dip UTSW 3 97695005 missense probably damaging 1.00
R4679:Pde4dip UTSW 3 97695005 missense probably damaging 1.00
R4688:Pde4dip UTSW 3 97843677 nonsense probably null
R4770:Pde4dip UTSW 3 97767084 missense probably damaging 1.00
R4841:Pde4dip UTSW 3 97793528 missense probably damaging 1.00
R4842:Pde4dip UTSW 3 97793528 missense probably damaging 1.00
R4899:Pde4dip UTSW 3 97709558 missense probably damaging 1.00
R4914:Pde4dip UTSW 3 97715328 missense probably benign 0.10
R4943:Pde4dip UTSW 3 97755511 missense probably damaging 0.99
R5131:Pde4dip UTSW 3 97709514 missense probably damaging 0.98
R5408:Pde4dip UTSW 3 97796736 missense probably benign 0.35
R5583:Pde4dip UTSW 3 97747576 missense possibly damaging 0.67
R5677:Pde4dip UTSW 3 97841648 nonsense probably null
R5696:Pde4dip UTSW 3 97709490 missense probably damaging 1.00
R5860:Pde4dip UTSW 3 97724188 missense possibly damaging 0.68
R6279:Pde4dip UTSW 3 97699180 missense probably damaging 1.00
R6341:Pde4dip UTSW 3 97694911 missense probably benign
R6440:Pde4dip UTSW 3 97767586 missense probably damaging 1.00
R6464:Pde4dip UTSW 3 97710344 missense probably damaging 1.00
R6489:Pde4dip UTSW 3 97755591 nonsense probably null
R6706:Pde4dip UTSW 3 97741393 missense probably damaging 1.00
R6722:Pde4dip UTSW 3 97718239 nonsense probably null
R6798:Pde4dip UTSW 3 97888534 missense probably benign
R6804:Pde4dip UTSW 3 97793248 nonsense probably null
R6862:Pde4dip UTSW 3 97767024 missense possibly damaging 0.52
R6957:Pde4dip UTSW 3 97824333 splice site probably null
R6983:Pde4dip UTSW 3 97718236 missense probably damaging 1.00
R7014:Pde4dip UTSW 3 97715422 missense possibly damaging 0.54
R7025:Pde4dip UTSW 3 97724183 nonsense probably null
R7136:Pde4dip UTSW 3 97694063 missense probably benign 0.03
R7178:Pde4dip UTSW 3 97715630 missense probably benign 0.26
R7269:Pde4dip UTSW 3 97766959 missense probably damaging 1.00
R7283:Pde4dip UTSW 3 97758882 missense probably benign 0.03
R7354:Pde4dip UTSW 3 97719330 missense probably damaging 0.99
R7357:Pde4dip UTSW 3 97715541 missense probably benign 0.01
R7360:Pde4dip UTSW 3 97718316 missense probably benign 0.01
R7371:Pde4dip UTSW 3 97757271 missense probably benign 0.08
R7432:Pde4dip UTSW 3 97695092 missense probably benign
R7536:Pde4dip UTSW 3 97757244 missense probably damaging 1.00
R7542:Pde4dip UTSW 3 97766655 missense possibly damaging 0.59
R7609:Pde4dip UTSW 3 97715565 missense possibly damaging 0.85
R7650:Pde4dip UTSW 3 97699107 critical splice donor site probably null
R7800:Pde4dip UTSW 3 97715283 missense probably damaging 1.00
R7846:Pde4dip UTSW 3 97715174 missense probably damaging 1.00
R7918:Pde4dip UTSW 3 97715223 nonsense probably null
R8120:Pde4dip UTSW 3 97706938 missense probably null 0.94
R8139:Pde4dip UTSW 3 97696993 missense probably benign 0.02
R8144:Pde4dip UTSW 3 97715426 missense probably damaging 1.00
R8177:Pde4dip UTSW 3 97767532 missense probably damaging 0.98
R8294:Pde4dip UTSW 3 97767378 missense probably damaging 1.00
R8406:Pde4dip UTSW 3 97699112 missense probably benign 0.04
R8911:Pde4dip UTSW 3 97743601 missense probably benign 0.22
R8912:Pde4dip UTSW 3 97710317 missense probably damaging 1.00
R8960:Pde4dip UTSW 3 97793148 missense probably damaging 1.00
R8993:Pde4dip UTSW 3 97766494 missense probably damaging 1.00
R9031:Pde4dip UTSW 3 97692359 missense probably damaging 1.00
R9032:Pde4dip UTSW 3 97694069 missense probably benign 0.00
R9085:Pde4dip UTSW 3 97694069 missense probably benign 0.00
R9103:Pde4dip UTSW 3 97841728 missense probably damaging 1.00
R9163:Pde4dip UTSW 3 97751807 critical splice donor site probably null
R9182:Pde4dip UTSW 3 97694998 missense probably benign 0.13
R9185:Pde4dip UTSW 3 97758816 missense probably benign 0.01
R9286:Pde4dip UTSW 3 97699867 missense probably damaging 1.00
R9357:Pde4dip UTSW 3 97718329 missense probably benign 0.00
R9415:Pde4dip UTSW 3 97753152 missense possibly damaging 0.82
R9500:Pde4dip UTSW 3 97888580 missense unknown
R9595:Pde4dip UTSW 3 97694891 critical splice donor site probably null
R9689:Pde4dip UTSW 3 97742525 missense probably damaging 1.00
R9720:Pde4dip UTSW 3 97695971 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCAACTGCACTCCATTTCC -3'
(R):5'- TTGCAGCAGATGAACAGTGAC -3'

Sequencing Primer
(F):5'- GGAGGCGGGACTTGCTGAG -3'
(R):5'- TGCAGCAGATGAACAGTGACTAGAG -3'
Posted On 2017-12-01