Mutagenetix > Incidental Mutations

Incidental Mutation 'R5689:Pde4dip'

501293

Institutional Source

Beutler Lab

Gene Symbol

Pde4dip

Ensembl Gene

ENSMUSG00000038170

Gene Name

phosphodiesterase 4D interacting protein (myomegalin)

Synonyms

D130016K21Rik, Usmg4, 4732458A06Rik, D3Bwg1078e, 9430063L05Rik

MMRRC Submission

043322-MU

Accession Numbers

Genbank:NM_001039376.2, NM_001110163.1, NM_178080.4, NM_177145.3; MGI: 1891434; Ensembl: ENSMUST00000045243, ENSMUST00000090750, ENSMUST00000107038, ENSMUST00000163531, ENSMUST00000168438

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5689 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

97689824-97888707 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 97692367 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Stop codon at position 2384 (L2384*)

Ref Sequence

ENSEMBL: ENSMUSP00000131170 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000090750] [ENSMUST00000168438]

Predicted Effect

probably null
Transcript: ENSMUST00000090750
AA Change: L2435*

SMART Domains

Protein: ENSMUSP00000088254
Gene: ENSMUSG00000038170
AA Change: L2435*

Domain	Start	End	E-Value	Type
low complexity region	10	40	N/A	INTRINSIC
low complexity region	45	57	N/A	INTRINSIC
Pfam:Cnn_1N	124	196	3.2e-26	PFAM
low complexity region	204	219	N/A	INTRINSIC
coiled coil region	282	325	N/A	INTRINSIC
internal_repeat_1	397	438	4.03e-5	PROSPERO
low complexity region	567	578	N/A	INTRINSIC
internal_repeat_2	617	667	6.59e-5	PROSPERO
internal_repeat_1	620	661	4.03e-5	PROSPERO
coiled coil region	866	942	N/A	INTRINSIC
low complexity region	1038	1056	N/A	INTRINSIC
low complexity region	1067	1082	N/A	INTRINSIC
coiled coil region	1118	1163	N/A	INTRINSIC
coiled coil region	1336	1363	N/A	INTRINSIC
low complexity region	1403	1420	N/A	INTRINSIC
coiled coil region	1470	1508	N/A	INTRINSIC
internal_repeat_2	1597	1644	6.59e-5	PROSPERO
DUF1220	1680	1747	1.17e-17	SMART
low complexity region	1758	1780	N/A	INTRINSIC
low complexity region	1836	1851	N/A	INTRINSIC
low complexity region	1860	1874	N/A	INTRINSIC
low complexity region	1940	1951	N/A	INTRINSIC
coiled coil region	1962	2138	N/A	INTRINSIC
coiled coil region	2162	2197	N/A	INTRINSIC
coiled coil region	2387	2431	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000168438
AA Change: L2384*

SMART Domains

Protein: ENSMUSP00000131170
Gene: ENSMUSG00000038170
AA Change: L2384*

Domain	Start	End	E-Value	Type
low complexity region	10	40	N/A	INTRINSIC
low complexity region	45	57	N/A	INTRINSIC
Pfam:Microtub_assoc	124	198	1.4e-31	PFAM
low complexity region	204	219	N/A	INTRINSIC
coiled coil region	282	325	N/A	INTRINSIC
internal_repeat_1	397	438	3.56e-5	PROSPERO
low complexity region	567	578	N/A	INTRINSIC
internal_repeat_2	617	667	5.83e-5	PROSPERO
internal_repeat_1	620	661	3.56e-5	PROSPERO
coiled coil region	866	942	N/A	INTRINSIC
low complexity region	1038	1056	N/A	INTRINSIC
low complexity region	1067	1082	N/A	INTRINSIC
coiled coil region	1118	1163	N/A	INTRINSIC
coiled coil region	1336	1363	N/A	INTRINSIC
low complexity region	1403	1420	N/A	INTRINSIC
coiled coil region	1470	1508	N/A	INTRINSIC
internal_repeat_2	1597	1644	5.83e-5	PROSPERO
DUF1220	1680	1747	1.17e-17	SMART
low complexity region	1758	1769	N/A	INTRINSIC
low complexity region	1785	1800	N/A	INTRINSIC
low complexity region	1809	1823	N/A	INTRINSIC
low complexity region	1889	1900	N/A	INTRINSIC
coiled coil region	1911	2087	N/A	INTRINSIC
coiled coil region	2111	2146	N/A	INTRINSIC
coiled coil region	2336	2380	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000184178

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000197791

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000200063

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.5%
3x: 98.8%
10x: 97.5%
20x: 95.8%

Validation Efficiency

95% (63/66)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene serves to anchor phosphodiesterase 4D to the Golgi/centrosome region of the cell. Defects in this gene may be a cause of myeloproliferative disorder (MBD) associated with eosinophilia. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit partial (in utero or perinatal) lethality, hyperactivity, and increased vertical activity. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adcy7	G	T	8: 88,324,784	C844F	probably benign	Het
Afdn	T	C	17: 13,855,359	V945A	probably damaging	Het
Aimp2	T	C	5: 143,906,571	D67G	possibly damaging	Het
Aqp7	G	A	4: 41,035,510	T115I	probably benign	Het
Atp11b	G	T	3: 35,834,352	V924F	possibly damaging	Het
Atp8b1	C	T	18: 64,564,537	R412H	probably damaging	Het
Cfb	T	A	17: 34,861,794	T76S	probably benign	Het
Cmpk2	A	T	12: 26,469,767	H139L	probably benign	Het
Cypt4	T	C	9: 24,625,246	S11P	possibly damaging	Het
Dbx1	A	G	7: 49,632,771	F229L	probably damaging	Het
Dnah6	T	A	6: 73,021,227	M4071L	probably benign	Het
Dnah7a	A	G	1: 53,405,698	V3949A	possibly damaging	Het
Dnajc25	A	G	4: 59,017,716	E6G	probably damaging	Het
Dync2h1	C	A	9: 7,169,689	V263F	probably damaging	Het
Eno4	T	A	19: 58,970,656	D403E	probably benign	Het
Evi5l	C	T	8: 4,205,460	Q542*	probably null	Het
Fam135a	A	G	1: 24,029,053	S12P	probably benign	Het
Fam198a	T	C	9: 121,965,688	F303L	probably damaging	Het
Flnc	G	A	6: 29,441,592	A458T	probably benign	Het
Fnip1	T	C	11: 54,502,289	V517A	probably damaging	Het
Galc	G	T	12: 98,212,986	H361N	possibly damaging	Het
Gcnt1	T	A	19: 17,329,404	D319V	probably damaging	Het
Gm26996	T	C	6: 130,578,295		noncoding transcript	Het
Gm5321	A	T	7: 6,019,269		noncoding transcript	Het
Grin3b	T	C	10: 79,974,631	L657P	probably damaging	Het
Gstm5	T	C	3: 107,896,665	F54S	probably damaging	Het
Ilk	C	A	7: 105,741,650	L267I	probably benign	Het
Lifr	A	G	15: 7,184,804	Y713C	probably damaging	Het
Lnx2	A	T	5: 147,029,151	V386E	probably damaging	Het
Lrch1	T	C	14: 74,786,324	E587G	probably damaging	Het
Olfr1512	C	T	14: 52,372,757	V99M	possibly damaging	Het
Osgin1	A	G	8: 119,444,989	*173W	probably null	Het
Pcdhga7	C	A	18: 37,716,683	P581H	probably damaging	Het
Phf12	T	A	11: 78,023,725	N115K	probably damaging	Het
Pmel	A	G	10: 128,716,301	T335A	probably damaging	Het
Polr3e	C	A	7: 120,940,689	T579K	possibly damaging	Het
Ptprc	A	G	1: 138,117,777	V164A	probably benign	Het
Rapsn	T	C	2: 91,035,924	F43S	probably damaging	Het
Rarb	T	A	14: 16,434,177	I334F	probably damaging	Het
Rev3l	T	C	10: 39,794,958	Y167H	probably damaging	Het
Rnf146	T	C	10: 29,347,804	T29A	probably benign	Het
Rsf1	GC	GCGGCGGCGCC	7: 97,579,934		probably benign	Het
Slc35e2	C	T	4: 155,610,026	P10L	probably benign	Het
Slc5a10	C	T	11: 61,707,884	M223I	probably benign	Het
Slc7a11	C	G	3: 50,372,331	V494L	probably benign	Het
Slitrk6	C	T	14: 110,752,126	E50K	probably benign	Het
Smg8	A	G	11: 87,085,123	F544S	probably damaging	Het
Tnpo3	T	C	6: 29,571,064	M444V	possibly damaging	Het
Trav7d-4	G	A	14: 52,770,194	R48H	probably damaging	Het
Trim50	A	T	5: 135,353,662	T123S	probably damaging	Het
Trpc4ap	C	G	2: 155,671,035		probably null	Het
Ttn	T	A	2: 76,788,276	R14475S	probably damaging	Het
Uts2	A	T	4: 150,999,108	T59S	possibly damaging	Het
Vmn1r52	T	C	6: 90,179,250	S179P	possibly damaging	Het
Vmn2r116	A	G	17: 23,397,719	H537R	probably benign	Het
Vps16	C	T	2: 130,439,091	Q226*	probably null	Het
Zfhx2	T	C	14: 55,073,903	T445A	possibly damaging	Het
Zfp638	T	C	6: 83,929,072	V73A	probably damaging	Het

Other mutations in Pde4dip

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00332:Pde4dip	APN	3	97767277	missense	probably benign	0.00
IGL00543:Pde4dip	APN	3	97757624	missense	possibly damaging	0.91
IGL00979:Pde4dip	APN	3	97747758	splice site	probably benign
IGL01483:Pde4dip	APN	3	97754149	missense	probably damaging	1.00
IGL02122:Pde4dip	APN	3	97767421	missense	probably damaging	1.00
IGL02398:Pde4dip	APN	3	97766781	missense	probably benign
IGL02814:Pde4dip	APN	3	97767100	missense	probably damaging	1.00
IGL02826:Pde4dip	APN	3	97767087	missense	probably damaging	1.00
D3080:Pde4dip	UTSW	3	97766830	missense	probably damaging	1.00
R0077:Pde4dip	UTSW	3	97753126	nonsense	probably null
R0096:Pde4dip	UTSW	3	97767467	missense	probably damaging	0.99
R0277:Pde4dip	UTSW	3	97843712	missense	probably benign	0.01
R0304:Pde4dip	UTSW	3	97843712	missense	probably benign	0.01
R0616:Pde4dip	UTSW	3	97747533	missense	probably benign	0.09
R0676:Pde4dip	UTSW	3	97717097	splice site	probably benign
R1166:Pde4dip	UTSW	3	97713196	missense	possibly damaging	0.94
R1376:Pde4dip	UTSW	3	97743217	missense	probably damaging	0.99
R1376:Pde4dip	UTSW	3	97743217	missense	probably damaging	0.99
R1452:Pde4dip	UTSW	3	97724102	missense	probably damaging	1.00
R1550:Pde4dip	UTSW	3	97719704	missense	probably damaging	1.00
R1700:Pde4dip	UTSW	3	97703323	missense	probably benign	0.00
R1704:Pde4dip	UTSW	3	97754260	missense	probably benign	0.28
R1769:Pde4dip	UTSW	3	97695930	missense	probably benign	0.00
R1934:Pde4dip	UTSW	3	97692691	missense	possibly damaging	0.74
R1980:Pde4dip	UTSW	3	97756996	missense	possibly damaging	0.93
R2088:Pde4dip	UTSW	3	97754433	missense	probably null	1.00
R2143:Pde4dip	UTSW	3	97888519	missense	possibly damaging	0.86
R2149:Pde4dip	UTSW	3	97792836	missense	possibly damaging	0.64
R2156:Pde4dip	UTSW	3	97724218	missense	probably damaging	0.98
R2158:Pde4dip	UTSW	3	97757621	missense	probably benign	0.15
R2240:Pde4dip	UTSW	3	97724164	missense	probably benign	0.00
R2249:Pde4dip	UTSW	3	97793525	missense	probably damaging	1.00
R2256:Pde4dip	UTSW	3	97718184	missense	probably damaging	1.00
R2680:Pde4dip	UTSW	3	97701617	missense	possibly damaging	0.92
R2921:Pde4dip	UTSW	3	97719569	missense	probably benign
R3407:Pde4dip	UTSW	3	97754468	missense	probably damaging	1.00
R3736:Pde4dip	UTSW	3	97724111	missense	probably damaging	1.00
R3787:Pde4dip	UTSW	3	97715552	missense	possibly damaging	0.80
R3883:Pde4dip	UTSW	3	97713188	missense	probably damaging	1.00
R4437:Pde4dip	UTSW	3	97766569	missense	possibly damaging	0.52
R4528:Pde4dip	UTSW	3	97717022	missense	probably damaging	1.00
R4576:Pde4dip	UTSW	3	97754249	missense	probably damaging	1.00
R4600:Pde4dip	UTSW	3	97695944	missense	probably damaging	0.98
R4653:Pde4dip	UTSW	3	97767338	missense	probably damaging	0.99
R4678:Pde4dip	UTSW	3	97695005	missense	probably damaging	1.00
R4679:Pde4dip	UTSW	3	97695005	missense	probably damaging	1.00
R4688:Pde4dip	UTSW	3	97843677	nonsense	probably null
R4770:Pde4dip	UTSW	3	97767084	missense	probably damaging	1.00
R4841:Pde4dip	UTSW	3	97793528	missense	probably damaging	1.00
R4842:Pde4dip	UTSW	3	97793528	missense	probably damaging	1.00
R4899:Pde4dip	UTSW	3	97709558	missense	probably damaging	1.00
R4914:Pde4dip	UTSW	3	97715328	missense	probably benign	0.10
R4943:Pde4dip	UTSW	3	97755511	missense	probably damaging	0.99
R5131:Pde4dip	UTSW	3	97709514	missense	probably damaging	0.98
R5408:Pde4dip	UTSW	3	97796736	missense	probably benign	0.35
R5583:Pde4dip	UTSW	3	97747576	missense	possibly damaging	0.67
R5677:Pde4dip	UTSW	3	97841648	nonsense	probably null
R5696:Pde4dip	UTSW	3	97709490	missense	probably damaging	1.00
R5860:Pde4dip	UTSW	3	97724188	missense	possibly damaging	0.68
R6279:Pde4dip	UTSW	3	97699180	missense	probably damaging	1.00
R6341:Pde4dip	UTSW	3	97694911	missense	probably benign
R6440:Pde4dip	UTSW	3	97767586	missense	probably damaging	1.00
R6464:Pde4dip	UTSW	3	97710344	missense	probably damaging	1.00
R6489:Pde4dip	UTSW	3	97755591	nonsense	probably null
R6706:Pde4dip	UTSW	3	97741393	missense	probably damaging	1.00
R6722:Pde4dip	UTSW	3	97718239	nonsense	probably null
R6798:Pde4dip	UTSW	3	97888534	missense	probably benign
R6804:Pde4dip	UTSW	3	97793248	nonsense	probably null
R6862:Pde4dip	UTSW	3	97767024	missense	possibly damaging	0.52
R6957:Pde4dip	UTSW	3	97824333	splice site	probably null
R6983:Pde4dip	UTSW	3	97718236	missense	probably damaging	1.00
R7014:Pde4dip	UTSW	3	97715422	missense	possibly damaging	0.54
R7025:Pde4dip	UTSW	3	97724183	nonsense	probably null
R7136:Pde4dip	UTSW	3	97694063	missense	probably benign	0.03
R7178:Pde4dip	UTSW	3	97715630	missense	probably benign	0.26
R7269:Pde4dip	UTSW	3	97766959	missense	probably damaging	1.00
R7283:Pde4dip	UTSW	3	97758882	missense	probably benign	0.03
R7354:Pde4dip	UTSW	3	97719330	missense	probably damaging	0.99
R7357:Pde4dip	UTSW	3	97715541	missense	probably benign	0.01
R7360:Pde4dip	UTSW	3	97718316	missense	probably benign	0.01
R7371:Pde4dip	UTSW	3	97757271	missense	probably benign	0.08
R7432:Pde4dip	UTSW	3	97695092	missense	probably benign
R7536:Pde4dip	UTSW	3	97757244	missense	probably damaging	1.00
R7542:Pde4dip	UTSW	3	97766655	missense	possibly damaging	0.59
R7609:Pde4dip	UTSW	3	97715565	missense	possibly damaging	0.85
R7650:Pde4dip	UTSW	3	97699107	critical splice donor site	probably null
R7800:Pde4dip	UTSW	3	97715283	missense	probably damaging	1.00
R7846:Pde4dip	UTSW	3	97715174	missense	probably damaging	1.00
R7918:Pde4dip	UTSW	3	97715223	nonsense	probably null
R8120:Pde4dip	UTSW	3	97706938	missense	probably null	0.94
R8139:Pde4dip	UTSW	3	97696993	missense	probably benign	0.02
R8144:Pde4dip	UTSW	3	97715426	missense	probably damaging	1.00
R8177:Pde4dip	UTSW	3	97767532	missense	probably damaging	0.98
R8294:Pde4dip	UTSW	3	97767378	missense	probably damaging	1.00
R8406:Pde4dip	UTSW	3	97699112	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- GGCAACTGCACTCCATTTCC -3'
(R):5'- TTGCAGCAGATGAACAGTGAC -3'

Sequencing Primer
(F):5'- GGAGGCGGGACTTGCTGAG -3'
(R):5'- TGCAGCAGATGAACAGTGACTAGAG -3'

Posted On

2017-12-01