Incidental Mutation 'R5645:Cul5'
ID 501294
Institutional Source Beutler Lab
Gene Symbol Cul5
Ensembl Gene ENSMUSG00000032030
Gene Name cullin 5
Synonyms VACM-1, C030032G03Rik, C330021I08Rik, 8430423K24Rik, 4921514I20Rik
MMRRC Submission 043293-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R5645 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 53614582-53670014 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 53622943 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 630 (I630V)
Ref Sequence ENSEMBL: ENSMUSP00000133144 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034529] [ENSMUST00000120122] [ENSMUST00000166367]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000034529
AA Change: I657V

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000034529
Gene: ENSMUSG00000032030
AA Change: I657V

DomainStartEndE-ValueType
PDB:2WZK|A 76 461 N/A PDB
SCOP:d1ldja2 91 459 1e-109 SMART
CULLIN 510 661 1.12e-80 SMART
Cullin_Nedd8 782 849 5.12e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120122
AA Change: I453V

PolyPhen 2 Score 0.172 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000113490
Gene: ENSMUSG00000032030
AA Change: I453V

DomainStartEndE-ValueType
PDB:4JGH|D 1 258 N/A PDB
SCOP:d1ldja2 5 255 2e-75 SMART
CULLIN 306 457 1.12e-80 SMART
Cullin_Nedd8 578 645 5.12e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141803
Predicted Effect probably benign
Transcript: ENSMUST00000166367
AA Change: I630V

PolyPhen 2 Score 0.172 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000133144
Gene: ENSMUSG00000032030
AA Change: I630V

DomainStartEndE-ValueType
PDB:2WZK|A 76 434 N/A PDB
SCOP:d1ldja2 91 432 9e-99 SMART
CULLIN 483 634 1.12e-80 SMART
Cullin_Nedd8 755 822 5.12e-17 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit complete embryonic lethality. Mice heterozygous for a null allele exhibit decreased susceptibility to LPS-induced lung injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700102P08Rik A G 9: 108,397,204 I169V probably damaging Het
2310007B03Rik T C 1: 93,152,946 T413A probably damaging Het
4930503B20Rik C T 3: 146,650,509 E215K probably damaging Het
5830411N06Rik G A 7: 140,248,940 V171I possibly damaging Het
Abca6 T C 11: 110,250,408 E29G probably damaging Het
Acsm1 A G 7: 119,640,697 H288R probably damaging Het
Adamts12 A G 15: 11,277,420 T707A possibly damaging Het
Adcy2 C A 13: 68,729,202 probably null Het
Agbl4 A T 4: 111,657,330 I513F possibly damaging Het
Ak5 A T 3: 152,656,033 M84K possibly damaging Het
Akap1 T C 11: 88,845,627 T103A probably benign Het
Akap9 A G 5: 4,050,590 T2751A probably benign Het
Amer3 A T 1: 34,588,381 H567L possibly damaging Het
Ano6 A G 15: 95,920,351 Y325C probably benign Het
Apba2 A G 7: 64,695,806 E248G possibly damaging Het
Asap2 T A 12: 21,265,982 V967E probably damaging Het
Boc A G 16: 44,499,661 V320A probably damaging Het
Car13 T A 3: 14,645,120 Y41N possibly damaging Het
Ccdc162 T C 10: 41,552,356 T1976A probably benign Het
Cep295 A T 9: 15,332,794 H1455Q probably damaging Het
Cep295 C A 9: 15,335,108 S684I possibly damaging Het
Cr2 G T 1: 195,154,273 H861N probably damaging Het
Cyp2c37 G A 19: 39,994,152 V145I probably benign Het
Dnmt1 G A 9: 20,922,147 T500M probably damaging Het
Fam161a T A 11: 23,015,725 I6N probably damaging Het
Fam214a T A 9: 75,025,679 V976E probably damaging Het
Fry T C 5: 150,380,867 V574A probably damaging Het
Glb1l3 G T 9: 26,824,826 L553I probably benign Het
Gm1123 T C 9: 99,014,191 D212G probably benign Het
Grin2a T A 16: 9,992,226 D103V probably damaging Het
Heg1 A G 16: 33,706,963 I98V probably benign Het
Hmcn2 C A 2: 31,420,812 T3356N possibly damaging Het
Hpf1 T G 8: 60,896,800 I154S possibly damaging Het
Ifnar2 A G 16: 91,404,227 D452G possibly damaging Het
Ikbkap T C 4: 56,776,920 T626A possibly damaging Het
Iqcc A T 4: 129,616,527 H398Q possibly damaging Het
Iqgap3 T C 3: 88,117,699 I669T probably damaging Het
Itgae A G 11: 73,129,248 T859A probably damaging Het
Kansl1l T C 1: 66,801,344 M266V probably benign Het
Kbtbd3 A G 9: 4,331,426 D600G possibly damaging Het
Klf13 G A 7: 63,891,600 probably benign Het
Kmt2d A G 15: 98,844,397 probably benign Het
Lama1 A G 17: 67,802,948 D2188G probably damaging Het
Leng8 A G 7: 4,145,274 T682A probably damaging Het
Mslnl G T 17: 25,737,842 G34V possibly damaging Het
Mycbp2 A T 14: 103,188,608 S2360R probably damaging Het
Mycbp2 C A 14: 103,188,615 probably null Het
Nkx2-2 T C 2: 147,184,399 T140A probably damaging Het
Olfr1233 A T 2: 89,339,705 V199E possibly damaging Het
Olfr745 T C 14: 50,643,067 V262A probably benign Het
Oser1 C T 2: 163,407,045 R79H probably damaging Het
Pfas A G 11: 68,991,132 V909A probably damaging Het
Pkhd1l1 A G 15: 44,532,992 E1970G probably benign Het
Prph2 G T 17: 46,910,667 probably benign Het
Rusc2 G T 4: 43,425,758 A1288S probably benign Het
Sdha A G 13: 74,323,839 probably null Het
Sec16a T G 2: 26,439,895 T703P probably benign Het
Senp7 T A 16: 56,173,208 N724K possibly damaging Het
Skint1 A G 4: 112,025,502 I248V probably benign Het
Slc9a5 T C 8: 105,357,013 V395A probably benign Het
Slco1a4 T C 6: 141,834,659 N135S possibly damaging Het
Sncaip A G 18: 52,894,956 I412M probably damaging Het
Tacc2 A T 7: 130,624,051 D841V possibly damaging Het
Tekt1 A T 11: 72,351,837 H281Q probably benign Het
Tex46 G T 4: 136,612,917 M104I probably benign Het
Tjp3 T C 10: 81,278,620 probably null Het
Treh A G 9: 44,682,678 Y154C probably damaging Het
Trim80 T A 11: 115,446,785 L428Q probably damaging Het
Trpm6 A G 19: 18,853,604 K1278E probably damaging Het
Usp34 T C 11: 23,375,024 M990T possibly damaging Het
Vps9d1 A G 8: 123,247,748 S267P probably benign Het
Ywhae T C 11: 75,756,924 M160T probably benign Het
Zcchc11 G A 4: 108,557,373 R49H probably damaging Het
Other mutations in Cul5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01674:Cul5 APN 9 53635007 missense probably damaging 1.00
IGL02043:Cul5 APN 9 53658673 missense probably benign 0.26
IGL02145:Cul5 APN 9 53635075 splice site probably benign
IGL02261:Cul5 APN 9 53635037 missense probably damaging 1.00
IGL02281:Cul5 APN 9 53635049 missense possibly damaging 0.87
IGL02639:Cul5 APN 9 53655342 missense possibly damaging 0.89
IGL02697:Cul5 APN 9 53655331 missense probably benign
IGL02752:Cul5 APN 9 53634978 missense probably damaging 0.98
IGL03017:Cul5 APN 9 53644485 critical splice donor site probably null
IGL03031:Cul5 APN 9 53642675 splice site probably benign
IGL03196:Cul5 APN 9 53625880 missense probably damaging 0.99
R0142:Cul5 UTSW 9 53635050 missense probably damaging 0.98
R0415:Cul5 UTSW 9 53667070 missense probably benign 0.00
R1619:Cul5 UTSW 9 53658593 missense probably benign 0.00
R1675:Cul5 UTSW 9 53646683 missense probably benign 0.00
R2031:Cul5 UTSW 9 53667180 missense probably benign
R2059:Cul5 UTSW 9 53667156 missense probably damaging 0.98
R3401:Cul5 UTSW 9 53621212 missense probably benign 0.02
R3427:Cul5 UTSW 9 53617890 missense probably benign
R3701:Cul5 UTSW 9 53629216 missense probably damaging 0.99
R3702:Cul5 UTSW 9 53629216 missense probably damaging 0.99
R3815:Cul5 UTSW 9 53622943 missense probably benign 0.31
R3848:Cul5 UTSW 9 53617986 missense probably benign 0.34
R3849:Cul5 UTSW 9 53617986 missense probably benign 0.34
R3850:Cul5 UTSW 9 53617986 missense probably benign 0.34
R4592:Cul5 UTSW 9 53633727 splice site probably benign
R4690:Cul5 UTSW 9 53622871 missense probably damaging 1.00
R5154:Cul5 UTSW 9 53625867 missense probably damaging 1.00
R5173:Cul5 UTSW 9 53642734 missense probably benign
R5868:Cul5 UTSW 9 53658673 missense probably benign 0.26
R5975:Cul5 UTSW 9 53622793 missense probably damaging 1.00
R6251:Cul5 UTSW 9 53646794 missense probably benign 0.40
R6284:Cul5 UTSW 9 53623735 missense probably damaging 1.00
R6415:Cul5 UTSW 9 53646683 missense probably benign 0.00
R7178:Cul5 UTSW 9 53644526 missense probably benign 0.01
R7511:Cul5 UTSW 9 53625969 missense probably damaging 1.00
R7923:Cul5 UTSW 9 53624166 missense probably benign 0.00
R7940:Cul5 UTSW 9 53623769 missense probably benign 0.21
R8481:Cul5 UTSW 9 53646823 missense probably benign 0.00
R9483:Cul5 UTSW 9 53621174 missense probably benign 0.10
X0018:Cul5 UTSW 9 53622929 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCAGCTATGTGACACAATGC -3'
(R):5'- TGTAGAATCCAGTCTGATCCCC -3'

Sequencing Primer
(F):5'- CACAATGCTATTTTAAAAACAAAGCC -3'
(R):5'- CATGAGTGACCACATTGAGCTGC -3'
Posted On 2017-12-01