Incidental Mutation 'R5690:Ap1s1'
ID501296
Institutional Source Beutler Lab
Gene Symbol Ap1s1
Ensembl Gene ENSMUSG00000004849
Gene Nameadaptor protein complex AP-1, sigma 1
SynonymsAP19
MMRRC Submission 043323-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.168) question?
Stock #R5690 (G1)
Quality Score115
Status Not validated
Chromosome5
Chromosomal Location137034993-137046135 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) ATCCTCCTCCTCCTCCTCCTC to ATCCTCCTCCTCCTCCTC at 137037379 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000140815 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041543] [ENSMUST00000111080] [ENSMUST00000144303] [ENSMUST00000150603] [ENSMUST00000186451] [ENSMUST00000190827]
Predicted Effect probably benign
Transcript: ENSMUST00000041543
SMART Domains Protein: ENSMUSP00000048273
Gene: ENSMUSG00000037428

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 110 115 N/A INTRINSIC
low complexity region 147 169 N/A INTRINSIC
low complexity region 179 197 N/A INTRINSIC
low complexity region 218 231 N/A INTRINSIC
coiled coil region 307 412 N/A INTRINSIC
low complexity region 434 450 N/A INTRINSIC
low complexity region 478 488 N/A INTRINSIC
low complexity region 490 504 N/A INTRINSIC
low complexity region 510 518 N/A INTRINSIC
coiled coil region 576 613 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111080
SMART Domains Protein: ENSMUSP00000106709
Gene: ENSMUSG00000004849

DomainStartEndE-ValueType
Pfam:Clat_adaptor_s 1 142 5.6e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144303
SMART Domains Protein: ENSMUSP00000120895
Gene: ENSMUSG00000004849

DomainStartEndE-ValueType
Pfam:Clat_adaptor_s 1 142 5.2e-65 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150603
SMART Domains Protein: ENSMUSP00000115941
Gene: ENSMUSG00000004849

DomainStartEndE-ValueType
Pfam:Clat_adaptor_s 34 175 2.4e-64 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154183
Predicted Effect probably benign
Transcript: ENSMUST00000186451
SMART Domains Protein: ENSMUSP00000140735
Gene: ENSMUSG00000037428

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 110 115 N/A INTRINSIC
low complexity region 147 169 N/A INTRINSIC
low complexity region 179 197 N/A INTRINSIC
low complexity region 218 231 N/A INTRINSIC
coiled coil region 307 412 N/A INTRINSIC
low complexity region 434 450 N/A INTRINSIC
low complexity region 478 488 N/A INTRINSIC
low complexity region 490 504 N/A INTRINSIC
low complexity region 510 518 N/A INTRINSIC
coiled coil region 576 613 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190827
SMART Domains Protein: ENSMUSP00000140815
Gene: ENSMUSG00000037428

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 110 115 N/A INTRINSIC
low complexity region 147 169 N/A INTRINSIC
low complexity region 179 197 N/A INTRINSIC
low complexity region 218 231 N/A INTRINSIC
coiled coil region 307 412 N/A INTRINSIC
low complexity region 434 450 N/A INTRINSIC
low complexity region 478 488 N/A INTRINSIC
low complexity region 490 504 N/A INTRINSIC
low complexity region 510 518 N/A INTRINSIC
coiled coil region 576 613 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of the clathrin coat assembly complex which links clathrin to receptors in coated vesicles. These vesicles are involved in endocytosis and Golgi processing. This protein, as well as beta-prime-adaptin, gamma-adaptin, and the medium (mu) chain AP47, form the AP-1 assembly protein complex located at the Golgi vesicle. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008F13Rik G A 2: 156,865,314 V58I probably benign Het
2810474O19Rik T C 6: 149,328,237 L927S possibly damaging Het
4930533K18Rik A G 10: 70,923,314 probably benign Het
Acadl T C 1: 66,853,286 Y126C probably damaging Het
Ak6 A G 13: 100,655,621 probably null Het
Aqp7 G A 4: 41,035,510 T115I probably benign Het
Atp6v1e1 A T 6: 120,808,356 probably null Het
Axin1 A G 17: 26,194,937 Y792C probably damaging Het
C1s2 T C 6: 124,631,037 N233S probably benign Het
Ccer2 C A 7: 28,756,204 probably benign Het
Cfap46 A G 7: 139,638,353 S1481P probably benign Het
Cspg4 A T 9: 56,898,735 T2277S probably benign Het
Ctsl T A 13: 64,365,208 N300I probably damaging Het
Dnah2 T C 11: 69,491,544 I1247V probably benign Het
Dsg3 A T 18: 20,522,051 Q135L probably benign Het
Efcab14 G A 4: 115,760,047 V318M possibly damaging Het
Etl4 G A 2: 20,805,836 S910N probably benign Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Frmd4b T C 6: 97,353,203 E133G possibly damaging Het
Herc2 T C 7: 56,157,705 F2514S probably benign Het
Il18rap A G 1: 40,537,112 D261G possibly damaging Het
Klk1b16 A G 7: 44,140,894 probably null Het
Lrp1b A C 2: 40,750,894 probably null Het
Mrpl45 C A 11: 97,321,586 probably benign Het
Myh13 A G 11: 67,329,275 E150G probably damaging Het
Nbas T A 12: 13,336,284 V737D probably damaging Het
Ncr1 T C 7: 4,338,297 Y59H probably damaging Het
Nt5c1a T A 4: 123,215,939 V277E probably damaging Het
Ogfod1 T A 8: 94,058,141 S343T probably damaging Het
Otogl G A 10: 107,777,117 silent Het
Pcdhb18 G A 18: 37,490,484 R289Q probably benign Het
Pnpla1 A T 17: 28,878,372 I171F probably damaging Het
Rdh8 A G 9: 20,825,489 N259S probably damaging Het
Slc22a12 A G 19: 6,536,848 M496T probably benign Het
Slc8b1 G A 5: 120,513,205 W10* probably null Het
Smarcc2 G A 10: 128,484,407 G887S probably damaging Het
Smc1b A G 15: 85,112,773 S549P probably damaging Het
Synj2 A G 17: 6,035,527 M1181V probably benign Het
Tbx15 T C 3: 99,308,850 S76P probably damaging Het
Tbx2 A T 11: 85,837,053 I271F probably damaging Het
Thap4 A G 1: 93,716,630 probably null Het
Tmc2 A G 2: 130,232,386 Y333C probably damaging Het
Trcg1 C T 9: 57,241,811 P222L probably benign Het
Tubb3 T C 8: 123,421,306 V326A probably benign Het
Unc80 A C 1: 66,640,572 I2101L probably benign Het
Vmn1r19 T C 6: 57,404,795 L111S probably benign Het
Vps16 C T 2: 130,439,091 Q226* probably null Het
Xpo4 T C 14: 57,590,989 I805V probably benign Het
Other mutations in Ap1s1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01095:Ap1s1 APN 5 137041809 missense probably damaging 1.00
IGL01621:Ap1s1 APN 5 137041804 nonsense probably null
IGL02661:Ap1s1 APN 5 137037473 missense probably benign 0.01
IGL02850:Ap1s1 APN 5 137041780 missense possibly damaging 0.91
R1597:Ap1s1 UTSW 5 137043241 missense probably damaging 0.99
R2257:Ap1s1 UTSW 5 137041779 missense possibly damaging 0.94
R2964:Ap1s1 UTSW 5 137037503 missense probably damaging 1.00
R2966:Ap1s1 UTSW 5 137037503 missense probably damaging 1.00
R6164:Ap1s1 UTSW 5 137037386 unclassified probably benign
R7650:Ap1s1 UTSW 5 137045533 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACAGACGTCTTAGGTCTTGGGAAG -3'
(R):5'- CTCCCAGGTATGTGAGTTGGAC -3'

Sequencing Primer
(F):5'- TCTTGGGAAGAGCCTGAGC -3'
(R):5'- CCAGGTATGTGAGTTGGACATCATC -3'
Posted On2017-12-01