Incidental Mutation 'R5690:Frmd4b'
ID501297
Institutional Source Beutler Lab
Gene Symbol Frmd4b
Ensembl Gene ENSMUSG00000030064
Gene NameFERM domain containing 4B
Synonyms6030440G05Rik, GRSP1
MMRRC Submission 043323-MU
Accession Numbers

Ncbi RefSeq: NM_145148.2; MGI:2141794

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5690 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location97286867-97617541 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 97353203 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 133 (E133G)
Ref Sequence ENSEMBL: ENSMUSP00000108982 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032146] [ENSMUST00000113355] [ENSMUST00000113359]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032146
AA Change: E187G

PolyPhen 2 Score 0.558 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000032146
Gene: ENSMUSG00000030064
AA Change: E187G

DomainStartEndE-ValueType
B41 55 260 7.4e-35 SMART
FERM_C 264 365 8.7e-26 SMART
Pfam:DUF3338 395 529 4.5e-55 PFAM
coiled coil region 534 558 N/A INTRINSIC
low complexity region 571 592 N/A INTRINSIC
low complexity region 731 742 N/A INTRINSIC
low complexity region 941 958 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000113353
SMART Domains Protein: ENSMUSP00000108980
Gene: ENSMUSG00000030064

DomainStartEndE-ValueType
B41 55 260 7.4e-35 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000113355
AA Change: E133G

PolyPhen 2 Score 0.558 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000108982
Gene: ENSMUSG00000030064
AA Change: E133G

DomainStartEndE-ValueType
B41 1 206 4.5e-37 SMART
FERM_C 210 311 4.1e-30 SMART
Pfam:DUF3338 340 476 6.9e-58 PFAM
coiled coil region 480 504 N/A INTRINSIC
low complexity region 517 538 N/A INTRINSIC
low complexity region 677 688 N/A INTRINSIC
low complexity region 887 904 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113359
AA Change: E141G

PolyPhen 2 Score 0.184 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000108986
Gene: ENSMUSG00000030064
AA Change: E141G

DomainStartEndE-ValueType
B41 9 214 7.4e-35 SMART
FERM_C 218 319 8.7e-26 SMART
Pfam:DUF3338 348 484 8e-61 PFAM
coiled coil region 488 512 N/A INTRINSIC
low complexity region 525 546 N/A INTRINSIC
low complexity region 685 696 N/A INTRINSIC
low complexity region 895 912 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138301
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142589
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152385
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a GRP1-binding protein which contains a FERM protein interaction domain as well as two coiled coil domains. This protein may play a role as a scaffolding protein. [provided by RefSeq, Mar 2014]
Allele List at MGI

All alleles(24) : Targeted(2) Gene trapped(22)

Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008F13Rik G A 2: 156,865,314 V58I probably benign Het
2810474O19Rik T C 6: 149,328,237 L927S possibly damaging Het
4930533K18Rik A G 10: 70,923,314 probably benign Het
Acadl T C 1: 66,853,286 Y126C probably damaging Het
Ak6 A G 13: 100,655,621 probably null Het
Ap1s1 ATCCTCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTC 5: 137,037,379 probably benign Het
Aqp7 G A 4: 41,035,510 T115I probably benign Het
Atp6v1e1 A T 6: 120,808,356 probably null Het
Axin1 A G 17: 26,194,937 Y792C probably damaging Het
C1s2 T C 6: 124,631,037 N233S probably benign Het
Ccer2 C A 7: 28,756,204 probably benign Het
Cfap46 A G 7: 139,638,353 S1481P probably benign Het
Cspg4 A T 9: 56,898,735 T2277S probably benign Het
Ctsl T A 13: 64,365,208 N300I probably damaging Het
Dnah2 T C 11: 69,491,544 I1247V probably benign Het
Dsg3 A T 18: 20,522,051 Q135L probably benign Het
Efcab14 G A 4: 115,760,047 V318M possibly damaging Het
Etl4 G A 2: 20,805,836 S910N probably benign Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Herc2 T C 7: 56,157,705 F2514S probably benign Het
Il18rap A G 1: 40,537,112 D261G possibly damaging Het
Klk1b16 A G 7: 44,140,894 probably null Het
Lrp1b A C 2: 40,750,894 probably null Het
Mrpl45 C A 11: 97,321,586 probably benign Het
Myh13 A G 11: 67,329,275 E150G probably damaging Het
Nbas T A 12: 13,336,284 V737D probably damaging Het
Ncr1 T C 7: 4,338,297 Y59H probably damaging Het
Nt5c1a T A 4: 123,215,939 V277E probably damaging Het
Ogfod1 T A 8: 94,058,141 S343T probably damaging Het
Otogl G A 10: 107,777,117 silent Het
Pcdhb18 G A 18: 37,490,484 R289Q probably benign Het
Pnpla1 A T 17: 28,878,372 I171F probably damaging Het
Rdh8 A G 9: 20,825,489 N259S probably damaging Het
Slc22a12 A G 19: 6,536,848 M496T probably benign Het
Slc8b1 G A 5: 120,513,205 W10* probably null Het
Smarcc2 G A 10: 128,484,407 G887S probably damaging Het
Smc1b A G 15: 85,112,773 S549P probably damaging Het
Synj2 A G 17: 6,035,527 M1181V probably benign Het
Tbx15 T C 3: 99,308,850 S76P probably damaging Het
Tbx2 A T 11: 85,837,053 I271F probably damaging Het
Thap4 A G 1: 93,716,630 probably null Het
Tmc2 A G 2: 130,232,386 Y333C probably damaging Het
Trcg1 C T 9: 57,241,811 P222L probably benign Het
Tubb3 T C 8: 123,421,306 V326A probably benign Het
Unc80 A C 1: 66,640,572 I2101L probably benign Het
Vmn1r19 T C 6: 57,404,795 L111S probably benign Het
Vps16 C T 2: 130,439,091 Q226* probably null Het
Xpo4 T C 14: 57,590,989 I805V probably benign Het
Other mutations in Frmd4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00849:Frmd4b APN 6 97308060 missense probably damaging 1.00
IGL01478:Frmd4b APN 6 97328293 missense probably damaging 1.00
IGL01760:Frmd4b APN 6 97308702 missense probably damaging 1.00
IGL01777:Frmd4b APN 6 97295944 missense probably benign 0.03
IGL01960:Frmd4b APN 6 97295780 missense possibly damaging 0.93
IGL02408:Frmd4b APN 6 97295809 missense probably damaging 1.00
IGL02429:Frmd4b APN 6 97325429 splice site probably benign
IGL02525:Frmd4b APN 6 97412533 missense probably damaging 1.00
IGL02618:Frmd4b APN 6 97308105 nonsense probably null
IGL03051:Frmd4b APN 6 97295982 nonsense probably null
IGL03120:Frmd4b APN 6 97396245 missense possibly damaging 0.88
IGL03218:Frmd4b APN 6 97308114 missense probably benign 0.01
IGL03260:Frmd4b APN 6 97396224 missense probably damaging 1.00
IGL02984:Frmd4b UTSW 6 97296260 missense probably damaging 0.96
P0031:Frmd4b UTSW 6 97354030 missense probably damaging 1.00
R0055:Frmd4b UTSW 6 97323649 splice site probably benign
R0055:Frmd4b UTSW 6 97323649 splice site probably benign
R0058:Frmd4b UTSW 6 97423499 missense probably damaging 1.00
R0255:Frmd4b UTSW 6 97308086 missense probably damaging 1.00
R0437:Frmd4b UTSW 6 97423463 missense probably damaging 1.00
R0594:Frmd4b UTSW 6 97325426 splice site probably benign
R1525:Frmd4b UTSW 6 97296386 missense probably damaging 0.97
R1640:Frmd4b UTSW 6 97308673 missense possibly damaging 0.91
R1768:Frmd4b UTSW 6 97306764 missense possibly damaging 0.68
R1923:Frmd4b UTSW 6 97288454 missense probably benign 0.33
R2056:Frmd4b UTSW 6 97412487 critical splice donor site probably null
R2192:Frmd4b UTSW 6 97487616 missense probably damaging 0.98
R3809:Frmd4b UTSW 6 97323729 missense possibly damaging 0.49
R3831:Frmd4b UTSW 6 97412525 nonsense probably null
R4466:Frmd4b UTSW 6 97323653 critical splice donor site probably null
R4536:Frmd4b UTSW 6 97310732 missense possibly damaging 0.57
R4652:Frmd4b UTSW 6 97295755 missense probably benign 0.38
R4679:Frmd4b UTSW 6 97295666 missense possibly damaging 0.94
R4735:Frmd4b UTSW 6 97459259 start gained probably benign
R4793:Frmd4b UTSW 6 97295861 missense probably damaging 0.99
R4940:Frmd4b UTSW 6 97298090 missense probably damaging 1.00
R4948:Frmd4b UTSW 6 97306730 missense probably benign 0.06
R5092:Frmd4b UTSW 6 97295980 missense probably damaging 0.98
R5119:Frmd4b UTSW 6 97300314 missense probably benign 0.03
R5289:Frmd4b UTSW 6 97302348 splice site probably null
R5610:Frmd4b UTSW 6 97306791 missense probably benign
R6248:Frmd4b UTSW 6 97459212 missense probably benign 0.10
R6437:Frmd4b UTSW 6 97296267 missense probably damaging 1.00
R6459:Frmd4b UTSW 6 97487640 missense probably damaging 1.00
R6825:Frmd4b UTSW 6 97325476 missense possibly damaging 0.89
R6964:Frmd4b UTSW 6 97305197 missense probably damaging 1.00
R7110:Frmd4b UTSW 6 97296231 nonsense probably null
R7154:Frmd4b UTSW 6 97306746 missense probably damaging 1.00
R7764:Frmd4b UTSW 6 97295930 missense probably damaging 1.00
R8073:Frmd4b UTSW 6 97306713 missense probably benign 0.03
R8382:Frmd4b UTSW 6 97305248 missense probably benign
X0020:Frmd4b UTSW 6 97305365 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTGCCCTGAAACACTGTGAG -3'
(R):5'- TCTTGTGTTAAGGGTAAGACACATC -3'

Sequencing Primer
(F):5'- CCCTGAAACACTGTGAGAAAGTTTCG -3'
(R):5'- AGGGTAAGACACATCTCATATATACG -3'
Posted On2017-12-01