Incidental Mutation 'R5690:Tbx2'
ID501298
Institutional Source Beutler Lab
Gene Symbol Tbx2
Ensembl Gene ENSMUSG00000000093
Gene NameT-box 2
Synonyms
MMRRC Submission 043323-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5690 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location85832551-85841948 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 85837053 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 271 (I271F)
Ref Sequence ENSEMBL: ENSMUSP00000000095 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000095]
Predicted Effect probably damaging
Transcript: ENSMUST00000000095
AA Change: I271F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000000095
Gene: ENSMUSG00000000093
AA Change: I271F

DomainStartEndE-ValueType
low complexity region 28 75 N/A INTRINSIC
TBOX 104 292 2.44e-130 SMART
Pfam:TBX 305 382 1.5e-18 PFAM
low complexity region 391 408 N/A INTRINSIC
low complexity region 509 549 N/A INTRINSIC
SCOP:d1gkub1 582 612 5e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136117
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140673
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of a phylogenetically conserved family of genes that share a common DNA-binding domain, the T-box. T-box genes encode transcription factors involved in the regulation of developmental processes. This gene product is the human homolog of mouse Tbx2, and shares strong sequence similarity with Drosophila omb protein. Expression studies indicate that this gene may have a potential role in tumorigenesis as an immortalizing agent. Transcript heterogeneity due to alternative polyadenylation has been noted for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display embryonic lethality with abnormal cardiac and vascular development, edema, and polydactyly. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008F13Rik G A 2: 156,865,314 V58I probably benign Het
2810474O19Rik T C 6: 149,328,237 L927S possibly damaging Het
4930533K18Rik A G 10: 70,923,314 probably benign Het
Acadl T C 1: 66,853,286 Y126C probably damaging Het
Ak6 A G 13: 100,655,621 probably null Het
Ap1s1 ATCCTCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTC 5: 137,037,379 probably benign Het
Aqp7 G A 4: 41,035,510 T115I probably benign Het
Atp6v1e1 A T 6: 120,808,356 probably null Het
Axin1 A G 17: 26,194,937 Y792C probably damaging Het
C1s2 T C 6: 124,631,037 N233S probably benign Het
Ccer2 C A 7: 28,756,204 probably benign Het
Cfap46 A G 7: 139,638,353 S1481P probably benign Het
Cspg4 A T 9: 56,898,735 T2277S probably benign Het
Ctsl T A 13: 64,365,208 N300I probably damaging Het
Dnah2 T C 11: 69,491,544 I1247V probably benign Het
Dsg3 A T 18: 20,522,051 Q135L probably benign Het
Efcab14 G A 4: 115,760,047 V318M possibly damaging Het
Etl4 G A 2: 20,805,836 S910N probably benign Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Frmd4b T C 6: 97,353,203 E133G possibly damaging Het
Herc2 T C 7: 56,157,705 F2514S probably benign Het
Il18rap A G 1: 40,537,112 D261G possibly damaging Het
Klk1b16 A G 7: 44,140,894 probably null Het
Lrp1b A C 2: 40,750,894 probably null Het
Mrpl45 C A 11: 97,321,586 probably benign Het
Myh13 A G 11: 67,329,275 E150G probably damaging Het
Nbas T A 12: 13,336,284 V737D probably damaging Het
Ncr1 T C 7: 4,338,297 Y59H probably damaging Het
Nt5c1a T A 4: 123,215,939 V277E probably damaging Het
Ogfod1 T A 8: 94,058,141 S343T probably damaging Het
Otogl G A 10: 107,777,117 silent Het
Pcdhb18 G A 18: 37,490,484 R289Q probably benign Het
Pnpla1 A T 17: 28,878,372 I171F probably damaging Het
Rdh8 A G 9: 20,825,489 N259S probably damaging Het
Slc22a12 A G 19: 6,536,848 M496T probably benign Het
Slc8b1 G A 5: 120,513,205 W10* probably null Het
Smarcc2 G A 10: 128,484,407 G887S probably damaging Het
Smc1b A G 15: 85,112,773 S549P probably damaging Het
Synj2 A G 17: 6,035,527 M1181V probably benign Het
Tbx15 T C 3: 99,308,850 S76P probably damaging Het
Thap4 A G 1: 93,716,630 probably null Het
Tmc2 A G 2: 130,232,386 Y333C probably damaging Het
Trcg1 C T 9: 57,241,811 P222L probably benign Het
Tubb3 T C 8: 123,421,306 V326A probably benign Het
Unc80 A C 1: 66,640,572 I2101L probably benign Het
Vmn1r19 T C 6: 57,404,795 L111S probably benign Het
Vps16 C T 2: 130,439,091 Q226* probably null Het
Xpo4 T C 14: 57,590,989 I805V probably benign Het
Other mutations in Tbx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02499:Tbx2 APN 11 85840913 missense possibly damaging 0.82
PIT4480001:Tbx2 UTSW 11 85834735 missense probably damaging 1.00
R1295:Tbx2 UTSW 11 85834766 missense probably damaging 0.97
R1296:Tbx2 UTSW 11 85834766 missense probably damaging 0.97
R1384:Tbx2 UTSW 11 85833492 missense probably benign 0.01
R1501:Tbx2 UTSW 11 85834796 missense probably damaging 1.00
R3949:Tbx2 UTSW 11 85838275 nonsense probably null
R4451:Tbx2 UTSW 11 85840817 missense probably damaging 1.00
R5214:Tbx2 UTSW 11 85838437 missense probably benign 0.02
R6186:Tbx2 UTSW 11 85837846 nonsense probably null
R7211:Tbx2 UTSW 11 85834714 missense probably damaging 1.00
R7353:Tbx2 UTSW 11 85833489 missense probably damaging 0.96
R7529:Tbx2 UTSW 11 85840901 missense probably benign 0.02
R7573:Tbx2 UTSW 11 85833312 missense possibly damaging 0.70
R7626:Tbx2 UTSW 11 85840796 missense probably benign 0.00
R7762:Tbx2 UTSW 11 85835901 missense probably damaging 1.00
R7996:Tbx2 UTSW 11 85834790 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAAAGATCCCGTCATTTTCC -3'
(R):5'- CCTCATACAAACGGAGAGTGG -3'

Sequencing Primer
(F):5'- CAAAGATCCCGTCATTTTCCTAGATG -3'
(R):5'- GAGTGGGCAGCGTTAGC -3'
Posted On2017-12-01