Incidental Mutation 'R5690:Axin1'
ID501299
Institutional Source Beutler Lab
Gene Symbol Axin1
Ensembl Gene ENSMUSG00000024182
Gene Nameaxin 1
Synonyms
MMRRC Submission 043323-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5690 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location26138688-26195811 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 26194937 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 792 (Y792C)
Ref Sequence ENSEMBL: ENSMUSP00000132000 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025019] [ENSMUST00000039113] [ENSMUST00000074370] [ENSMUST00000118904] [ENSMUST00000120333] [ENSMUST00000121959] [ENSMUST00000163421] [ENSMUST00000176961]
Predicted Effect probably benign
Transcript: ENSMUST00000025019
SMART Domains Protein: ENSMUSP00000025019
Gene: ENSMUSG00000073433

DomainStartEndE-ValueType
low complexity region 6 28 N/A INTRINSIC
Pfam:Rho_GDI 29 222 1.2e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000039113
SMART Domains Protein: ENSMUSP00000035584
Gene: ENSMUSG00000024184

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Thioredoxin 46 153 1.5e-26 PFAM
Pfam:Thioredoxin_6 182 369 3.2e-37 PFAM
Pfam:Thioredoxin 392 497 2.4e-27 PFAM
low complexity region 501 515 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000074370
AA Change: Y828C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000073974
Gene: ENSMUSG00000024182
AA Change: Y828C

DomainStartEndE-ValueType
Pfam:AXIN1_TNKS_BD 13 85 7.5e-27 PFAM
RGS 93 216 3.03e-36 SMART
low complexity region 230 241 N/A INTRINSIC
low complexity region 330 344 N/A INTRINSIC
coiled coil region 394 432 N/A INTRINSIC
Pfam:Axin_b-cat_bind 468 523 3.2e-13 PFAM
low complexity region 533 544 N/A INTRINSIC
low complexity region 699 709 N/A INTRINSIC
low complexity region 713 727 N/A INTRINSIC
DAX 786 868 5.92e-45 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000118904
AA Change: Y792C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113756
Gene: ENSMUSG00000024182
AA Change: Y792C

DomainStartEndE-ValueType
RGS 93 216 3.03e-36 SMART
low complexity region 230 241 N/A INTRINSIC
low complexity region 330 344 N/A INTRINSIC
coiled coil region 394 432 N/A INTRINSIC
Pfam:Axin_b-cat_bind 468 502 1.2e-18 PFAM
low complexity region 533 544 N/A INTRINSIC
low complexity region 699 709 N/A INTRINSIC
coiled coil region 712 734 N/A INTRINSIC
DAX 750 832 5.92e-45 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120333
SMART Domains Protein: ENSMUSP00000114080
Gene: ENSMUSG00000024184

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Thioredoxin 46 153 2.6e-27 PFAM
Pfam:Thioredoxin_6 181 366 2e-37 PFAM
Pfam:Thioredoxin 389 494 7.2e-28 PFAM
low complexity region 498 512 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121959
SMART Domains Protein: ENSMUSP00000113186
Gene: ENSMUSG00000073433

DomainStartEndE-ValueType
Pfam:Rho_GDI 14 197 6.4e-65 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142410
SMART Domains Protein: ENSMUSP00000115267
Gene: ENSMUSG00000024184

DomainStartEndE-ValueType
Pfam:Thioredoxin 38 145 3.8e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148134
SMART Domains Protein: ENSMUSP00000116340
Gene: ENSMUSG00000024184

DomainStartEndE-ValueType
Pfam:Thioredoxin 19 124 2e-28 PFAM
low complexity region 128 142 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155556
Predicted Effect probably damaging
Transcript: ENSMUST00000163421
AA Change: Y792C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000132000
Gene: ENSMUSG00000024182
AA Change: Y792C

DomainStartEndE-ValueType
RGS 93 216 3.03e-36 SMART
low complexity region 230 241 N/A INTRINSIC
low complexity region 330 344 N/A INTRINSIC
coiled coil region 394 432 N/A INTRINSIC
Pfam:Axin_b-cat_bind 468 502 1.2e-18 PFAM
low complexity region 533 544 N/A INTRINSIC
low complexity region 699 709 N/A INTRINSIC
coiled coil region 712 734 N/A INTRINSIC
DAX 750 832 5.92e-45 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176847
Predicted Effect probably benign
Transcript: ENSMUST00000176961
SMART Domains Protein: ENSMUSP00000135717
Gene: ENSMUSG00000073433

DomainStartEndE-ValueType
Pfam:Rho_GDI 14 222 1.9e-83 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic protein which contains a regulation of G-protein signaling (RGS) domain and a dishevelled and axin (DIX) domain. The encoded protein interacts with adenomatosis polyposis coli, catenin beta-1, glycogen synthase kinase 3 beta, protein phosphate 2, and itself. This protein functions as a negative regulator of the wingless-type MMTV integration site family, member 1 (WNT) signaling pathway and can induce apoptosis. The crystal structure of a portion of this protein, alone and in a complex with other proteins, has been resolved. Mutations in this gene have been associated with hepatocellular carcinoma, hepatoblastomas, ovarian endometriod adenocarcinomas, and medullablastomas. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mutant homozygotes die at embryonic day 8-10, exhibiting neuroectodermal defects and axial duplications. Heterozygotes exhibit skeletal, cardiac, and neurological defects including short, bent tails, and deafness with circling behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008F13Rik G A 2: 156,865,314 V58I probably benign Het
2810474O19Rik T C 6: 149,328,237 L927S possibly damaging Het
4930533K18Rik A G 10: 70,923,314 probably benign Het
Acadl T C 1: 66,853,286 Y126C probably damaging Het
Ak6 A G 13: 100,655,621 probably null Het
Ap1s1 ATCCTCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTC 5: 137,037,379 probably benign Het
Aqp7 G A 4: 41,035,510 T115I probably benign Het
Atp6v1e1 A T 6: 120,808,356 probably null Het
C1s2 T C 6: 124,631,037 N233S probably benign Het
Ccer2 C A 7: 28,756,204 probably benign Het
Cfap46 A G 7: 139,638,353 S1481P probably benign Het
Cspg4 A T 9: 56,898,735 T2277S probably benign Het
Ctsl T A 13: 64,365,208 N300I probably damaging Het
Dnah2 T C 11: 69,491,544 I1247V probably benign Het
Dsg3 A T 18: 20,522,051 Q135L probably benign Het
Efcab14 G A 4: 115,760,047 V318M possibly damaging Het
Etl4 G A 2: 20,805,836 S910N probably benign Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Frmd4b T C 6: 97,353,203 E133G possibly damaging Het
Herc2 T C 7: 56,157,705 F2514S probably benign Het
Il18rap A G 1: 40,537,112 D261G possibly damaging Het
Klk1b16 A G 7: 44,140,894 probably null Het
Lrp1b A C 2: 40,750,894 probably null Het
Mrpl45 C A 11: 97,321,586 probably benign Het
Myh13 A G 11: 67,329,275 E150G probably damaging Het
Nbas T A 12: 13,336,284 V737D probably damaging Het
Ncr1 T C 7: 4,338,297 Y59H probably damaging Het
Nt5c1a T A 4: 123,215,939 V277E probably damaging Het
Ogfod1 T A 8: 94,058,141 S343T probably damaging Het
Otogl G A 10: 107,777,117 silent Het
Pcdhb18 G A 18: 37,490,484 R289Q probably benign Het
Pnpla1 A T 17: 28,878,372 I171F probably damaging Het
Rdh8 A G 9: 20,825,489 N259S probably damaging Het
Slc22a12 A G 19: 6,536,848 M496T probably benign Het
Slc8b1 G A 5: 120,513,205 W10* probably null Het
Smarcc2 G A 10: 128,484,407 G887S probably damaging Het
Smc1b A G 15: 85,112,773 S549P probably damaging Het
Synj2 A G 17: 6,035,527 M1181V probably benign Het
Tbx15 T C 3: 99,308,850 S76P probably damaging Het
Tbx2 A T 11: 85,837,053 I271F probably damaging Het
Thap4 A G 1: 93,716,630 probably null Het
Tmc2 A G 2: 130,232,386 Y333C probably damaging Het
Trcg1 C T 9: 57,241,811 P222L probably benign Het
Tubb3 T C 8: 123,421,306 V326A probably benign Het
Unc80 A C 1: 66,640,572 I2101L probably benign Het
Vmn1r19 T C 6: 57,404,795 L111S probably benign Het
Vps16 C T 2: 130,439,091 Q226* probably null Het
Xpo4 T C 14: 57,590,989 I805V probably benign Het
Other mutations in Axin1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Axin1 APN 17 26142805 missense possibly damaging 0.88
IGL00229:Axin1 APN 17 26194072 missense probably damaging 1.00
IGL01141:Axin1 APN 17 26190041 missense probably damaging 0.98
IGL02088:Axin1 APN 17 26188695 missense probably benign 0.05
IGL02413:Axin1 APN 17 26188179 missense probably benign 0.00
R0331:Axin1 UTSW 17 26143107 missense probably damaging 1.00
R0454:Axin1 UTSW 17 26173663 missense probably benign 0.00
R0538:Axin1 UTSW 17 26184241 missense possibly damaging 0.66
R0755:Axin1 UTSW 17 26182506 missense possibly damaging 0.95
R0976:Axin1 UTSW 17 26188086 missense probably damaging 1.00
R1634:Axin1 UTSW 17 26187991 missense probably damaging 0.99
R1950:Axin1 UTSW 17 26193964 missense possibly damaging 0.62
R1965:Axin1 UTSW 17 26184225 missense probably damaging 1.00
R1965:Axin1 UTSW 17 26190228 missense probably damaging 0.97
R2180:Axin1 UTSW 17 26143335 missense probably benign
R3051:Axin1 UTSW 17 26190125 missense probably benign 0.01
R3413:Axin1 UTSW 17 26188038 missense probably damaging 0.99
R3849:Axin1 UTSW 17 26187797 missense probably benign 0.01
R4530:Axin1 UTSW 17 26188172 missense probably benign 0.09
R4560:Axin1 UTSW 17 26173771 missense probably damaging 1.00
R4764:Axin1 UTSW 17 26173756 missense possibly damaging 0.46
R4976:Axin1 UTSW 17 26194070 missense probably benign 0.42
R4976:Axin1 UTSW 17 26194071 missense probably benign 0.24
R5299:Axin1 UTSW 17 26173734 missense probably damaging 0.99
R5682:Axin1 UTSW 17 26187801 missense probably benign
R5722:Axin1 UTSW 17 26182557 missense probably damaging 1.00
R5793:Axin1 UTSW 17 26143308 missense probably damaging 1.00
R6108:Axin1 UTSW 17 26143240 missense probably damaging 0.98
R6282:Axin1 UTSW 17 26143037 missense probably damaging 1.00
R6490:Axin1 UTSW 17 26142994 missense probably damaging 1.00
R7153:Axin1 UTSW 17 26187968 missense probably benign
R7181:Axin1 UTSW 17 26173778 missense probably damaging 1.00
R7456:Axin1 UTSW 17 26143165 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTCCCAACATGCTATTAACTCAGC -3'
(R):5'- CTGTCCACCTGACTGATGAC -3'

Sequencing Primer
(F):5'- ATGCTATTAACTCAGCCCATCAGTGG -3'
(R):5'- CTGATGACAGTGCACAGTAGTG -3'
Posted On2017-12-01