Incidental Mutation 'R5693:Lifr'
ID 501309
Institutional Source Beutler Lab
Gene Symbol Lifr
Ensembl Gene ENSMUSG00000054263
Gene Name LIF receptor alpha
Synonyms soluble differentiation-stimulating factor receptor, A230075M04Rik
MMRRC Submission 043180-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5693 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 7120095-7226970 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 7205041 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 426 (V426A)
Ref Sequence ENSEMBL: ENSMUSP00000154181 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067190] [ENSMUST00000164529] [ENSMUST00000171588] [ENSMUST00000226471] [ENSMUST00000226934] [ENSMUST00000227727]
AlphaFold P42703
Predicted Effect probably damaging
Transcript: ENSMUST00000067190
AA Change: V426A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000064551
Gene: ENSMUSG00000054263
AA Change: V426A

DomainStartEndE-ValueType
low complexity region 25 37 N/A INTRINSIC
Blast:FN3 45 118 5e-22 BLAST
FN3 328 399 1.86e1 SMART
FN3 425 515 9.77e-5 SMART
FN3 530 611 2.68e0 SMART
FN3 620 705 8.23e1 SMART
FN3 719 815 4.81e-4 SMART
transmembrane domain 830 852 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000164529
AA Change: V426A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131434
Gene: ENSMUSG00000054263
AA Change: V426A

DomainStartEndE-ValueType
low complexity region 25 37 N/A INTRINSIC
Blast:FN3 45 118 4e-22 BLAST
FN3 328 399 1.86e1 SMART
FN3 425 515 9.77e-5 SMART
FN3 530 611 2.68e0 SMART
FN3 620 705 8.23e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000171588
AA Change: V426A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126137
Gene: ENSMUSG00000054263
AA Change: V426A

DomainStartEndE-ValueType
low complexity region 25 37 N/A INTRINSIC
Blast:FN3 45 118 5e-22 BLAST
FN3 328 399 1.86e1 SMART
FN3 425 515 9.77e-5 SMART
FN3 530 611 2.68e0 SMART
FN3 620 705 8.23e1 SMART
FN3 719 815 4.81e-4 SMART
transmembrane domain 830 852 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000226471
AA Change: V426A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000226934
AA Change: V426A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000227727
AA Change: V426A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the type I cytokine receptor family. This protein combines with a high-affinity converter subunit, gp130, to form a receptor complex that mediates the action of the leukemia inhibitory factor, a polyfunctional cytokine that is involved in cellular differentiation, proliferation and survival in the adult and the embryo. Mutations in this gene cause Schwartz-Jampel syndrome type 2, a disease belonging to the group of the bent-bone dysplasias. A translocation that involves the promoter of this gene, t(5;8)(p13;q12) with the pleiomorphic adenoma gene 1, is associated with salivary gland pleiomorphic adenoma, a common type of benign epithelial tumor of the salivary gland. Multiple splice variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations die as neonates with reduced numbers of facial and spinal motor neurons, neurons of the nucleus ambiguus, and astrocytes. Mutants also show impaired placentation, severe osteopenia, and low hepatic glycogen stores. [provided by MGI curators]
Allele List at MGI

All alleles(22) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(19)

Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,266,233 (GRCm39) I3071V probably benign Het
Abcb8 C T 5: 24,605,137 (GRCm39) R108C possibly damaging Het
Abr T C 11: 76,354,403 (GRCm39) N236S probably damaging Het
Adcy6 T C 15: 98,501,870 (GRCm39) Y248C probably damaging Het
Armc8 A G 9: 99,378,202 (GRCm39) probably null Het
Chd6 A T 2: 160,807,185 (GRCm39) S2010T probably benign Het
Dcc G A 18: 71,708,153 (GRCm39) T521I probably damaging Het
Dmrtb1 G A 4: 107,541,366 (GRCm39) probably benign Het
Evc A G 5: 37,477,584 (GRCm39) V365A possibly damaging Het
Gata4 A G 14: 63,478,594 (GRCm39) Y2H probably damaging Het
Gpc1 A G 1: 92,785,621 (GRCm39) N437S probably damaging Het
Lpin3 A G 2: 160,737,320 (GRCm39) I122M probably benign Het
Muc4 A G 16: 32,597,181 (GRCm39) N3174D possibly damaging Het
Myo6 G A 9: 80,173,462 (GRCm39) R534H probably damaging Het
Nectin2 T C 7: 19,458,794 (GRCm39) D339G probably benign Het
Oprd1 G A 4: 131,871,721 (GRCm39) probably benign Het
Or6c66 T C 10: 129,461,396 (GRCm39) D178G probably damaging Het
Orc1 G A 4: 108,470,276 (GRCm39) V751I probably benign Het
Pacs2 T C 12: 113,013,526 (GRCm39) S175P probably damaging Het
Pik3r5 C T 11: 68,385,077 (GRCm39) R661C probably damaging Het
Plscr5 A T 9: 92,087,564 (GRCm39) K178* probably null Het
Prkar1b A G 5: 139,113,400 (GRCm39) V40A possibly damaging Het
Ptprf G A 4: 118,093,374 (GRCm39) R90* probably null Het
Rasef T C 4: 73,688,076 (GRCm39) M26V probably damaging Het
Rfx1 C A 8: 84,800,533 (GRCm39) Q45K unknown Het
Rnf183 A G 4: 62,346,753 (GRCm39) V15A possibly damaging Het
Slc10a2 C A 8: 5,155,128 (GRCm39) C19F probably damaging Het
Slc14a2 T A 18: 78,190,229 (GRCm39) I907F probably benign Het
Snx16 T C 3: 10,485,318 (GRCm39) I293V probably benign Het
Srcap C A 7: 127,118,988 (GRCm39) A97E probably damaging Het
Thyn1 G T 9: 26,916,511 (GRCm39) probably null Het
Tiparp T C 3: 65,460,913 (GRCm39) I634T possibly damaging Het
Tjp1 G A 7: 64,992,411 (GRCm39) A156V possibly damaging Het
Tmem168 T C 6: 13,602,320 (GRCm39) M349V probably benign Het
Tyro3 T G 2: 119,641,349 (GRCm39) F519L probably damaging Het
Vmn1r167 A T 7: 23,204,646 (GRCm39) Y123* probably null Het
Vmn1r183 C T 7: 23,754,227 (GRCm39) T10I possibly damaging Het
Zfp654 T C 16: 64,606,289 (GRCm39) T97A probably benign Het
Other mutations in Lifr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00702:Lifr APN 15 7,215,220 (GRCm39) splice site probably null
IGL01470:Lifr APN 15 7,205,147 (GRCm39) nonsense probably null
IGL01489:Lifr APN 15 7,205,037 (GRCm39) splice site probably benign
IGL01619:Lifr APN 15 7,220,643 (GRCm39) missense probably damaging 1.00
IGL01636:Lifr APN 15 7,208,499 (GRCm39) splice site probably benign
IGL01943:Lifr APN 15 7,217,630 (GRCm39) missense probably damaging 1.00
IGL02253:Lifr APN 15 7,220,085 (GRCm39) missense probably damaging 1.00
IGL02355:Lifr APN 15 7,194,174 (GRCm39) critical splice donor site probably null
IGL02362:Lifr APN 15 7,194,174 (GRCm39) critical splice donor site probably null
IGL02450:Lifr APN 15 7,220,246 (GRCm39) missense probably damaging 1.00
IGL02477:Lifr APN 15 7,216,404 (GRCm39) missense probably damaging 1.00
IGL02503:Lifr APN 15 7,215,104 (GRCm39) missense probably damaging 1.00
IGL02571:Lifr APN 15 7,219,592 (GRCm39) unclassified probably benign
IGL03340:Lifr APN 15 7,207,417 (GRCm39) missense probably benign 0.02
N/A - 535:Lifr UTSW 15 7,216,434 (GRCm39) missense possibly damaging 0.80
R0012:Lifr UTSW 15 7,205,089 (GRCm39) missense possibly damaging 0.78
R0015:Lifr UTSW 15 7,217,667 (GRCm39) splice site probably null
R0102:Lifr UTSW 15 7,208,373 (GRCm39) missense probably damaging 0.98
R0102:Lifr UTSW 15 7,208,373 (GRCm39) missense probably damaging 0.98
R0305:Lifr UTSW 15 7,206,982 (GRCm39) missense probably damaging 0.99
R0416:Lifr UTSW 15 7,196,395 (GRCm39) missense probably damaging 1.00
R0440:Lifr UTSW 15 7,186,672 (GRCm39) nonsense probably null
R0519:Lifr UTSW 15 7,207,061 (GRCm39) missense probably damaging 1.00
R0595:Lifr UTSW 15 7,206,950 (GRCm39) missense probably damaging 1.00
R0601:Lifr UTSW 15 7,198,753 (GRCm39) splice site probably null
R0780:Lifr UTSW 15 7,206,947 (GRCm39) missense probably benign 0.00
R0790:Lifr UTSW 15 7,215,196 (GRCm39) missense probably benign 0.13
R1376:Lifr UTSW 15 7,214,245 (GRCm39) missense probably benign 0.04
R1376:Lifr UTSW 15 7,214,245 (GRCm39) missense probably benign 0.04
R1400:Lifr UTSW 15 7,220,346 (GRCm39) missense probably benign 0.04
R1498:Lifr UTSW 15 7,220,099 (GRCm39) missense probably damaging 0.99
R1785:Lifr UTSW 15 7,211,337 (GRCm39) missense possibly damaging 0.89
R1786:Lifr UTSW 15 7,211,337 (GRCm39) missense possibly damaging 0.89
R1906:Lifr UTSW 15 7,217,612 (GRCm39) missense probably damaging 0.98
R2099:Lifr UTSW 15 7,186,732 (GRCm39) missense probably benign
R2102:Lifr UTSW 15 7,216,404 (GRCm39) missense probably damaging 1.00
R2136:Lifr UTSW 15 7,211,338 (GRCm39) missense possibly damaging 0.89
R2511:Lifr UTSW 15 7,196,397 (GRCm39) missense probably benign
R4375:Lifr UTSW 15 7,196,379 (GRCm39) missense probably benign
R4883:Lifr UTSW 15 7,215,106 (GRCm39) missense possibly damaging 0.94
R5681:Lifr UTSW 15 7,220,565 (GRCm39) missense probably damaging 1.00
R5689:Lifr UTSW 15 7,214,285 (GRCm39) missense probably damaging 1.00
R5902:Lifr UTSW 15 7,220,231 (GRCm39) missense probably benign
R5918:Lifr UTSW 15 7,188,897 (GRCm39) missense probably benign 0.00
R5924:Lifr UTSW 15 7,202,453 (GRCm39) missense probably benign 0.28
R6037:Lifr UTSW 15 7,216,424 (GRCm39) missense probably damaging 1.00
R6037:Lifr UTSW 15 7,216,424 (GRCm39) missense probably damaging 1.00
R6289:Lifr UTSW 15 7,196,391 (GRCm39) missense probably benign 0.00
R6339:Lifr UTSW 15 7,196,530 (GRCm39) missense probably benign 0.01
R6860:Lifr UTSW 15 7,202,418 (GRCm39) missense probably benign 0.02
R7106:Lifr UTSW 15 7,202,405 (GRCm39) missense probably benign 0.02
R7107:Lifr UTSW 15 7,208,421 (GRCm39) missense possibly damaging 0.88
R7274:Lifr UTSW 15 7,196,540 (GRCm39) critical splice donor site probably null
R7625:Lifr UTSW 15 7,198,723 (GRCm39) missense probably damaging 0.99
R7631:Lifr UTSW 15 7,214,258 (GRCm39) missense probably damaging 1.00
R7958:Lifr UTSW 15 7,211,478 (GRCm39) missense possibly damaging 0.62
R7991:Lifr UTSW 15 7,202,963 (GRCm39) missense possibly damaging 0.79
R8175:Lifr UTSW 15 7,216,496 (GRCm39) missense probably damaging 1.00
R8427:Lifr UTSW 15 7,220,462 (GRCm39) missense probably benign 0.01
R9274:Lifr UTSW 15 7,217,591 (GRCm39) missense probably damaging 0.98
R9311:Lifr UTSW 15 7,208,418 (GRCm39) missense possibly damaging 0.47
R9365:Lifr UTSW 15 7,198,521 (GRCm39) missense probably damaging 1.00
R9509:Lifr UTSW 15 7,188,955 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAACAGGTCCATGGGTTCCG -3'
(R):5'- CTGTCCAGTAACAAATGTGCAAATG -3'

Sequencing Primer
(F):5'- GCCCAGACTGTCTTGGCTTTG -3'
(R):5'- CCTGGTAAATACCAAGAAAATG -3'
Posted On 2017-12-01