Incidental Mutation 'R5649:Naa35'
ID501310
Institutional Source Beutler Lab
Gene Symbol Naa35
Ensembl Gene ENSMUSG00000021555
Gene NameN(alpha)-acetyltransferase 35, NatC auxiliary subunit
SynonymsMak10, A330021G12Rik, C030004C14Rik, A330027C19Rik
MMRRC Submission 043170-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.967) question?
Stock #R5649 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location59585259-59635922 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to A at 59622866 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000127270 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022038] [ENSMUST00000164011] [ENSMUST00000165253] [ENSMUST00000172419]
Predicted Effect silent
Transcript: ENSMUST00000022038
SMART Domains Protein: ENSMUSP00000022038
Gene: ENSMUSG00000021555

DomainStartEndE-ValueType
Pfam:Mak10 45 145 2.2e-29 PFAM
Pfam:Mak10 141 194 3.7e-10 PFAM
low complexity region 561 568 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163395
Predicted Effect probably benign
Transcript: ENSMUST00000164011
SMART Domains Protein: ENSMUSP00000127270
Gene: ENSMUSG00000021555

DomainStartEndE-ValueType
Pfam:Mak10 1 119 1.9e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165129
Predicted Effect silent
Transcript: ENSMUST00000165253
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165841
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168242
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168633
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171391
Predicted Effect silent
Transcript: ENSMUST00000172166
Predicted Effect silent
Transcript: ENSMUST00000172419
SMART Domains Protein: ENSMUSP00000126079
Gene: ENSMUSG00000021555

DomainStartEndE-ValueType
Pfam:Mak10 40 193 1.2e-55 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224194
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009B22Rik T C 11: 51,685,972 E33G probably benign Het
Abca12 T C 1: 71,291,342 T1385A probably damaging Het
Apc2 T A 10: 80,314,138 D1646E probably damaging Het
Aspm G A 1: 139,479,669 R2098H probably benign Het
Atl3 C A 19: 7,532,227 T435N possibly damaging Het
Cdh22 G T 2: 165,116,280 T589K probably damaging Het
Cnot3 T C 7: 3,658,083 L561S probably benign Het
Col5a1 A G 2: 27,951,456 D363G unknown Het
Cyp24a1 T C 2: 170,496,309 D105G possibly damaging Het
Dennd4a C A 9: 64,851,209 probably null Het
Dnah8 A G 17: 30,800,587 K3878R probably benign Het
Dock4 T C 12: 40,844,540 S1900P probably benign Het
Fancg A G 4: 43,008,736 L167P probably damaging Het
Ighd2-8 A G 12: 113,450,867 S1P possibly damaging Het
Kif28 A G 1: 179,697,771 probably null Het
Mrpl55 T A 11: 59,204,571 C20* probably null Het
Myo5a A G 9: 75,171,719 K920E possibly damaging Het
Olfm3 A G 3: 115,096,924 R76G probably damaging Het
Olfr304 T C 7: 86,386,313 M116V probably damaging Het
Olfr705 T C 7: 106,714,166 R172G possibly damaging Het
Pcdha12 A T 18: 37,022,415 D729V probably benign Het
Phf11c T C 14: 59,385,532 probably null Het
Phf20 T A 2: 156,251,768 probably null Het
Plbd1 T A 6: 136,616,989 Y376F probably benign Het
Poglut1 A G 16: 38,531,811 V257A probably damaging Het
Reln A G 5: 21,901,625 I3249T probably benign Het
Rgsl1 G A 1: 153,825,893 P272S possibly damaging Het
Slc15a2 A T 16: 36,772,110 Y197* probably null Het
Slc45a2 C T 15: 11,012,607 T232I probably benign Het
Ssc5d T A 7: 4,926,518 probably null Het
Thbs2 T C 17: 14,689,953 Y128C probably damaging Het
Them4 A T 3: 94,331,544 L219F possibly damaging Het
Tmem30b G T 12: 73,546,166 N58K probably benign Het
Ttc29 G A 8: 78,246,313 E131K possibly damaging Het
Vmn1r29 C G 6: 58,307,691 S132C probably benign Het
Vmn1r53 G A 6: 90,223,760 A194V probably benign Het
Wdr86 A T 5: 24,718,087 H202Q probably benign Het
Xirp2 A G 2: 67,516,895 D3160G probably benign Het
Xkr5 T C 8: 18,933,966 D520G probably benign Het
Zfp607b T G 7: 27,703,981 C621G probably damaging Het
Other mutations in Naa35
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00476:Naa35 APN 13 59630055 missense probably damaging 1.00
IGL00743:Naa35 APN 13 59630671 missense probably benign 0.33
IGL01335:Naa35 APN 13 59616796 missense probably damaging 1.00
IGL01385:Naa35 APN 13 59601066 missense probably damaging 1.00
IGL01541:Naa35 APN 13 59600963 missense probably damaging 1.00
IGL02129:Naa35 APN 13 59609525 missense probably damaging 0.99
IGL02867:Naa35 APN 13 59608854 intron probably benign
IGL02966:Naa35 APN 13 59586271 missense probably benign
IGL03260:Naa35 APN 13 59627885 missense probably benign 0.05
R0312:Naa35 UTSW 13 59609581 missense probably benign 0.01
R0557:Naa35 UTSW 13 59627964 missense probably damaging 0.99
R1553:Naa35 UTSW 13 59618279 critical splice donor site probably null
R1611:Naa35 UTSW 13 59628933 missense probably benign 0.01
R1676:Naa35 UTSW 13 59612676 missense probably damaging 1.00
R3709:Naa35 UTSW 13 59618032 splice site probably benign
R3896:Naa35 UTSW 13 59607295 missense probably damaging 1.00
R5001:Naa35 UTSW 13 59625531 missense possibly damaging 0.75
R5647:Naa35 UTSW 13 59622866 unclassified probably benign
R5650:Naa35 UTSW 13 59622866 unclassified probably benign
R5656:Naa35 UTSW 13 59622866 unclassified probably benign
R6734:Naa35 UTSW 13 59608191 missense possibly damaging 0.83
R6735:Naa35 UTSW 13 59625564 missense probably damaging 1.00
R6985:Naa35 UTSW 13 59627943 missense probably benign 0.03
R7165:Naa35 UTSW 13 59586183 missense probably benign 0.05
R7531:Naa35 UTSW 13 59617941 nonsense probably null
R7713:Naa35 UTSW 13 59598105 missense probably benign 0.01
R7739:Naa35 UTSW 13 59599784 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTTTGGACACCTTACTCTGAC -3'
(R):5'- TACTCACTCAAGCAGTAAGAGGAG -3'

Sequencing Primer
(F):5'- GGACACCTTACTCTGACTACACTTG -3'
(R):5'- CTGTGCAGCATAATTTTCCA -3'
Posted On2017-12-01