Incidental Mutation 'R5658:Tbc1d5'
ID501317
Institutional Source Beutler Lab
Gene Symbol Tbc1d5
Ensembl Gene ENSMUSG00000023923
Gene NameTBC1 domain family, member 5
Synonyms1600014N05Rik
MMRRC Submission 043172-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5658 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location50733124-51179352 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 50813841 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 416 (R416G)
Ref Sequence ENSEMBL: ENSMUSP00000153172 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024717] [ENSMUST00000224528]
Predicted Effect probably benign
Transcript: ENSMUST00000024717
AA Change: R416G

PolyPhen 2 Score 0.180 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000024717
Gene: ENSMUSG00000023923
AA Change: R416G

DomainStartEndE-ValueType
TBC 78 384 5.56e-86 SMART
low complexity region 475 492 N/A INTRINSIC
SCOP:d1lsha3 511 546 1e-3 SMART
low complexity region 556 568 N/A INTRINSIC
low complexity region 783 802 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000224528
AA Change: R416G

PolyPhen 2 Score 0.181 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224977
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225252
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522H14Rik A G 4: 109,505,447 L221P probably damaging Het
Art2b A G 7: 101,580,362 V110A probably damaging Het
Bccip A G 7: 133,717,620 I147V possibly damaging Het
Bcl9l G T 9: 44,509,169 G1254W probably damaging Het
Cep68 C T 11: 20,241,885 probably null Het
Chst5 A G 8: 111,890,790 V66A probably damaging Het
F5 C A 1: 164,192,338 T794K probably damaging Het
Faf2 T C 13: 54,641,534 V55A probably benign Het
Gm7535 T A 17: 17,911,320 probably benign Het
Gm853 A G 4: 130,220,441 V61A probably benign Het
Gm9833 C T 3: 10,088,777 S202F probably damaging Het
Itpr3 T C 17: 27,107,878 V1471A possibly damaging Het
Kbtbd4 T A 2: 90,906,079 S145T probably benign Het
Kcnh3 C T 15: 99,242,076 P948S possibly damaging Het
Kcnq1 G A 7: 143,363,695 probably null Het
Kng2 T C 16: 22,997,020 probably null Het
Krt9 A G 11: 100,190,767 I312T probably damaging Het
Lactb2 T A 1: 13,627,418 H254L probably benign Het
Lama5 A T 2: 180,208,276 Y187* probably null Het
Maf1 T C 15: 76,353,220 V154A possibly damaging Het
Mlh1 A G 9: 111,247,380 V303A probably damaging Het
Mrgprh A T 17: 12,877,759 K295N possibly damaging Het
Mtrr G T 13: 68,568,915 A393D possibly damaging Het
Nebl A G 2: 17,348,852 Y963H probably damaging Het
Ormdl1 T C 1: 53,308,934 V145A probably damaging Het
Plekha6 G C 1: 133,272,307 R208P possibly damaging Het
Pmpcb A G 5: 21,739,001 T78A probably damaging Het
Ptprz1 G A 6: 23,016,189 R1677Q probably damaging Het
Rad54l2 ACCTCCTCCTCCTCCTCCTCCTCCTC ACCTCCTCCTCCTCCTCCTCCTC 9: 106,753,992 probably benign Het
Ryr1 A T 7: 29,091,089 probably null Het
Sh3bp2 T A 5: 34,556,947 I162N probably damaging Het
Slc38a10 C T 11: 120,105,392 A960T probably benign Het
Sntb1 C T 15: 55,792,076 C248Y probably damaging Het
Sowahc G A 10: 59,223,227 R395H possibly damaging Het
Tnfaip6 A T 2: 52,051,035 Y196F possibly damaging Het
Tpo A G 12: 30,055,138 L911P possibly damaging Het
Try5 T C 6: 41,312,427 R72G probably damaging Het
Vwa8 T C 14: 78,982,398 probably null Het
Other mutations in Tbc1d5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01287:Tbc1d5 APN 17 50813798 missense possibly damaging 0.52
IGL01370:Tbc1d5 APN 17 50966727 missense probably benign 0.18
IGL01625:Tbc1d5 APN 17 50917573 missense probably benign 0.27
IGL01935:Tbc1d5 APN 17 50963765 splice site probably benign
IGL02229:Tbc1d5 APN 17 50852600 missense probably damaging 1.00
IGL02811:Tbc1d5 APN 17 50800121 missense probably damaging 0.99
IGL03192:Tbc1d5 APN 17 50984681 splice site probably benign
FR4976:Tbc1d5 UTSW 17 50799931 missense probably benign
FR4976:Tbc1d5 UTSW 17 50799943 missense probably benign 0.01
IGL02796:Tbc1d5 UTSW 17 50966624 missense probably damaging 1.00
R0153:Tbc1d5 UTSW 17 50984687 splice site probably benign
R0326:Tbc1d5 UTSW 17 50966736 missense probably damaging 1.00
R0417:Tbc1d5 UTSW 17 50756705 missense probably benign 0.18
R0481:Tbc1d5 UTSW 17 50919051 missense probably damaging 0.98
R1143:Tbc1d5 UTSW 17 50742059 nonsense probably null
R1533:Tbc1d5 UTSW 17 50920575 missense possibly damaging 0.89
R1543:Tbc1d5 UTSW 17 50935532 missense probably benign 0.32
R2888:Tbc1d5 UTSW 17 50935549 missense probably damaging 1.00
R3153:Tbc1d5 UTSW 17 50968236 missense probably damaging 1.00
R3430:Tbc1d5 UTSW 17 50800128 missense probably damaging 1.00
R3898:Tbc1d5 UTSW 17 50963744 missense probably damaging 0.98
R4116:Tbc1d5 UTSW 17 50920587 missense probably damaging 1.00
R4352:Tbc1d5 UTSW 17 50782401 missense probably damaging 0.98
R4456:Tbc1d5 UTSW 17 50782341 missense probably damaging 1.00
R4648:Tbc1d5 UTSW 17 50736223 missense probably benign
R4711:Tbc1d5 UTSW 17 50935509 missense probably damaging 0.98
R4754:Tbc1d5 UTSW 17 50800165 missense probably benign 0.03
R5303:Tbc1d5 UTSW 17 50736200 missense probably benign 0.00
R5360:Tbc1d5 UTSW 17 50984632 missense probably benign 0.26
R5443:Tbc1d5 UTSW 17 50735967 missense probably damaging 0.98
R5444:Tbc1d5 UTSW 17 50735967 missense probably damaging 0.98
R5611:Tbc1d5 UTSW 17 50735967 missense probably damaging 0.98
R5701:Tbc1d5 UTSW 17 50799955 small deletion probably benign
R5921:Tbc1d5 UTSW 17 50963693 missense probably damaging 1.00
R6280:Tbc1d5 UTSW 17 50782310 missense probably benign 0.01
R6628:Tbc1d5 UTSW 17 50736208 missense probably benign
R6705:Tbc1d5 UTSW 17 51025175 start gained probably benign
R6990:Tbc1d5 UTSW 17 50968232 missense probably benign 0.19
R7184:Tbc1d5 UTSW 17 50800082 missense probably benign 0.00
R7443:Tbc1d5 UTSW 17 50966735 missense probably damaging 1.00
R7484:Tbc1d5 UTSW 17 50917545 missense possibly damaging 0.68
R7696:Tbc1d5 UTSW 17 50874577 missense probably damaging 1.00
R7787:Tbc1d5 UTSW 17 50874683 nonsense probably null
R7827:Tbc1d5 UTSW 17 50782263 missense probably damaging 0.99
R7841:Tbc1d5 UTSW 17 50799922 small deletion probably benign
R7861:Tbc1d5 UTSW 17 50756692 missense probably damaging 0.99
R7924:Tbc1d5 UTSW 17 50799922 small deletion probably benign
R7944:Tbc1d5 UTSW 17 50756692 missense probably damaging 0.99
R8108:Tbc1d5 UTSW 17 50742086 missense probably benign 0.01
R8245:Tbc1d5 UTSW 17 50799922 small deletion probably benign
Z1088:Tbc1d5 UTSW 17 50963696 missense probably damaging 1.00
Z1177:Tbc1d5 UTSW 17 50966553 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCTAGAAAACAGTCCTTAGGAAAG -3'
(R):5'- CAGCATAGGTCACAATGGAGTATGC -3'

Sequencing Primer
(F):5'- AGATGTACAAATTCCCCATGGCTTC -3'
(R):5'- CTCAGTTTTCATCAGCCAAGAAAG -3'
Posted On2017-12-01