Incidental Mutation 'R5663:Nr4a3'
ID501329
Institutional Source Beutler Lab
Gene Symbol Nr4a3
Ensembl Gene ENSMUSG00000028341
Gene Namenuclear receptor subfamily 4, group A, member 3
SynonymsNor1, TEC, MINOR, NOR-1
MMRRC Submission 043306-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5663 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location48045153-48086447 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 48055931 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Isoleucine at position 319 (R319I)
Ref Sequence ENSEMBL: ENSMUSP00000030025 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030025]
Predicted Effect probably damaging
Transcript: ENSMUST00000030025
AA Change: R319I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030025
Gene: ENSMUSG00000028341
AA Change: R319I

DomainStartEndE-ValueType
Blast:HOLI 1 43 4e-18 BLAST
low complexity region 99 115 N/A INTRINSIC
low complexity region 139 151 N/A INTRINSIC
low complexity region 196 210 N/A INTRINSIC
low complexity region 218 239 N/A INTRINSIC
low complexity region 269 288 N/A INTRINSIC
ZnF_C4 290 361 4.57e-39 SMART
low complexity region 376 396 N/A INTRINSIC
HOLI 440 595 2.46e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133539
Predicted Effect unknown
Transcript: ENSMUST00000153369
AA Change: R348I
SMART Domains Protein: ENSMUSP00000121455
Gene: ENSMUSG00000028341
AA Change: R348I

DomainStartEndE-ValueType
Blast:HOLI 30 73 8e-19 BLAST
low complexity region 129 145 N/A INTRINSIC
low complexity region 169 181 N/A INTRINSIC
low complexity region 226 240 N/A INTRINSIC
low complexity region 248 269 N/A INTRINSIC
low complexity region 299 318 N/A INTRINSIC
ZnF_C4 320 391 4.57e-39 SMART
low complexity region 406 426 N/A INTRINSIC
HOLI 470 625 2.46e-21 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the NR4A subfamily of nuclear hormone receptors that bind to DNA and modulate gene expression. The encoded protein has been implicated in T and B lymphocyte apoptosis, and immune cell proliferation. Mice lacking the encoded protein exhibit partial bidirectional circling behavior and inner ear dysfunction. Disruption of this gene in mice also results in defective hippocampal axonal growth and postnatal neuronal cell death. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit defects in the semicircular canals of the inner ear and bidirectional circling behavior. Mice homozygous for another null allele display embryonic lethality with impaired cell migration during gastrulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016K19Rik A G 11: 76,000,221 K54E probably damaging Het
1700021F07Rik C T 2: 173,527,897 P68L probably damaging Het
5330417C22Rik T C 3: 108,492,083 T64A probably benign Het
Adgra3 T C 5: 49,999,285 N368D probably benign Het
Agfg1 T A 1: 82,893,452 S444R probably damaging Het
Arhgap44 A T 11: 65,024,291 F384I probably damaging Het
Atp8b2 T C 3: 89,941,794 N1078D probably benign Het
Bcan G A 3: 87,995,613 T286I probably damaging Het
Cacna1d A G 14: 30,123,340 L624P probably damaging Het
Dnah7c C A 1: 46,535,148 F994L probably damaging Het
Dpp6 A G 5: 27,049,622 I12V possibly damaging Het
Edil3 A G 13: 89,042,508 I101M probably damaging Het
Fam160a1 T C 3: 85,672,433 T822A probably benign Het
Farp2 T C 1: 93,570,013 V255A probably damaging Het
Fzr1 A G 10: 81,370,526 S137P probably benign Het
Gm884 A G 11: 103,613,123 V497A probably benign Het
H2-Eb2 T C 17: 34,333,408 F76L possibly damaging Het
Helb A G 10: 120,105,793 I330T possibly damaging Het
Il18rap T A 1: 40,531,557 C220S probably damaging Het
Kdm4c T C 4: 74,399,348 V966A probably damaging Het
Kdm5b T C 1: 134,630,635 V1460A probably benign Het
Kif15 T A 9: 122,991,851 probably null Het
Masp1 T C 16: 23,452,938 E621G possibly damaging Het
Mier1 T A 4: 103,150,542 S285T probably damaging Het
Mroh6 A G 15: 75,888,588 S46P probably benign Het
Myo1h A T 5: 114,334,094 Q395L probably damaging Het
Ndufb5 T C 3: 32,747,749 I86T possibly damaging Het
Nelfb T A 2: 25,203,489 E417V probably benign Het
Nfkb1 T G 3: 135,603,851 D494A possibly damaging Het
Nid1 G A 13: 13,472,834 C395Y probably damaging Het
Olfr1508 A T 14: 52,463,595 I138K probably benign Het
Olfr523 G A 7: 140,176,321 C67Y probably damaging Het
Olfr695 T A 7: 106,873,670 T192S probably benign Het
Paqr5 A G 9: 61,968,862 V130A probably benign Het
Phlpp2 G A 8: 109,904,344 V207I probably benign Het
Pik3ca C T 3: 32,462,779 T1052M probably damaging Het
Pikfyve T C 1: 65,216,028 Y347H probably benign Het
Ptprz1 A G 6: 23,035,143 H1964R probably damaging Het
Rassf7 C T 7: 141,217,090 T72I probably damaging Het
Rfx3 A G 19: 27,793,617 F603S probably damaging Het
Slc27a4 T A 2: 29,812,370 V477D probably damaging Het
Slc9a3 A C 13: 74,163,712 D593A probably damaging Het
Smyd1 A G 6: 71,239,721 I14T probably benign Het
Sox6 T A 7: 115,550,054 I404L probably benign Het
Tas2r121 G A 6: 132,700,557 H151Y probably benign Het
Tgfb1 C T 7: 25,694,281 T192M possibly damaging Het
Ubr4 T C 4: 139,428,583 Y2240H possibly damaging Het
Whrn T A 4: 63,418,448 N626Y probably damaging Het
Wisp2 G A 2: 163,825,253 R58Q probably damaging Het
Xrra1 T A 7: 99,886,043 I185N probably damaging Het
Zfp94 G A 7: 24,302,827 R397W probably damaging Het
Other mutations in Nr4a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01362:Nr4a3 APN 4 48051586 missense possibly damaging 0.48
IGL01407:Nr4a3 APN 4 48083201 missense probably benign 0.00
IGL01454:Nr4a3 APN 4 48067803 missense probably damaging 1.00
IGL01472:Nr4a3 APN 4 48071133 missense probably damaging 1.00
IGL02622:Nr4a3 APN 4 48051649 missense probably benign 0.06
IGL03401:Nr4a3 APN 4 48070987 splice site probably null
bulbous UTSW 4 48083255 missense probably damaging 0.98
cronus UTSW 4 48056539 missense probably damaging 1.00
I1329:Nr4a3 UTSW 4 48051585 missense probably benign 0.12
R0486:Nr4a3 UTSW 4 48056525 splice site probably benign
R0610:Nr4a3 UTSW 4 48051903 missense probably benign 0.10
R1170:Nr4a3 UTSW 4 48051564 missense probably damaging 0.98
R1170:Nr4a3 UTSW 4 48083324 missense probably benign 0.01
R1440:Nr4a3 UTSW 4 48051777 missense probably benign
R1977:Nr4a3 UTSW 4 48056539 missense probably damaging 1.00
R2016:Nr4a3 UTSW 4 48083252 missense probably damaging 1.00
R2046:Nr4a3 UTSW 4 48067807 missense possibly damaging 0.82
R2055:Nr4a3 UTSW 4 48067771 missense possibly damaging 0.86
R3707:Nr4a3 UTSW 4 48056699 missense probably damaging 0.99
R3708:Nr4a3 UTSW 4 48056699 missense probably damaging 0.99
R4246:Nr4a3 UTSW 4 48083125 missense possibly damaging 0.86
R4657:Nr4a3 UTSW 4 48051522 missense probably damaging 1.00
R4870:Nr4a3 UTSW 4 48051651 missense possibly damaging 0.73
R5434:Nr4a3 UTSW 4 48067861 missense probably damaging 1.00
R5539:Nr4a3 UTSW 4 48056525 splice site probably null
R6513:Nr4a3 UTSW 4 48083255 missense probably damaging 0.98
R6664:Nr4a3 UTSW 4 48056006 missense probably damaging 1.00
R6921:Nr4a3 UTSW 4 48051486 missense probably benign 0.04
R6940:Nr4a3 UTSW 4 48051486 missense probably benign 0.04
R7076:Nr4a3 UTSW 4 48055957 missense probably damaging 1.00
R7322:Nr4a3 UTSW 4 48083238 missense probably benign 0.00
R7347:Nr4a3 UTSW 4 48051290 missense possibly damaging 0.94
R7348:Nr4a3 UTSW 4 48051290 missense possibly damaging 0.94
R7349:Nr4a3 UTSW 4 48051290 missense possibly damaging 0.94
R7361:Nr4a3 UTSW 4 48083203 missense probably benign 0.00
R7365:Nr4a3 UTSW 4 48051290 missense possibly damaging 0.94
R7366:Nr4a3 UTSW 4 48051290 missense possibly damaging 0.94
R7418:Nr4a3 UTSW 4 48051476 missense probably damaging 1.00
R7659:Nr4a3 UTSW 4 48051269 missense probably damaging 1.00
R7895:Nr4a3 UTSW 4 48051390 missense probably benign
R7978:Nr4a3 UTSW 4 48051390 missense probably benign
R8022:Nr4a3 UTSW 4 48051510 missense probably damaging 1.00
R8226:Nr4a3 UTSW 4 48056588 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACTGTCAGCCAGGAACAC -3'
(R):5'- TAGGAAAATGCACTGCCTCAATG -3'

Sequencing Primer
(F):5'- GTCAGCCAGGAACACTAATAAAATTG -3'
(R):5'- TCATGGTCTGAGGGTAAGTATTAGC -3'
Posted On2017-12-01