Mutagenetix > Incidental Mutation

Incidental Mutation 'R5665:Uso1'

501334

Institutional Source

Beutler Lab

Gene Symbol

Uso1

Ensembl Gene

ENSMUSG00000029407

Gene Name

USO1 vesicle docking factor

Synonyms

Vdp, TAP, transcytosis associated protein p115

MMRRC Submission

043308-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5665 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

92137938-92202798 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 92198337 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Valine at position 793 (E793V)

Ref Sequence

ENSEMBL: ENSMUSP00000031355 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031355] [ENSMUST00000201642] [ENSMUST00000202155]

AlphaFold

Q9Z1Z0

Predicted Effect

possibly damaging
Transcript: ENSMUST00000031355
AA Change: E793V

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000031355
Gene: ENSMUSG00000029407
AA Change: E793V

Domain	Start	End	E-Value	Type
Blast:ARM	47	91	1e-18	BLAST
low complexity region	94	100	N/A	INTRINSIC
Blast:ARM	155	195	2e-15	BLAST
Blast:ARM	300	342	3e-19	BLAST
Pfam:Uso1_p115_head	344	628	6.5e-72	PFAM
low complexity region	630	643	N/A	INTRINSIC
low complexity region	661	672	N/A	INTRINSIC
low complexity region	730	744	N/A	INTRINSIC
Pfam:Uso1_p115_C	782	954	1.6e-12	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000122796

Predicted Effect

probably benign
Transcript: ENSMUST00000201642

SMART Domains

Protein: ENSMUSP00000144165
Gene: ENSMUSG00000029407

Domain	Start	End	E-Value	Type
PDB:3GRL\|A	1	52	5e-24	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000202155

SMART Domains

Protein: ENSMUSP00000144592
Gene: ENSMUSG00000029407

Domain	Start	End	E-Value	Type
Blast:ARM	47	91	1e-18	BLAST
low complexity region	94	100	N/A	INTRINSIC
Blast:ARM	155	195	2e-15	BLAST
Blast:ARM	300	342	3e-19	BLAST
Pfam:Uso1_p115_head	344	628	5.7e-72	PFAM
low complexity region	630	643	N/A	INTRINSIC
low complexity region	661	672	N/A	INTRINSIC
Pfam:Uso1_p115_C	730	892	2.1e-14	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202362

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a peripheral membrane protein which recycles between the cytosol and the Golgi apparatus during interphase. It is regulated by phosphorylation: dephosphorylated protein associates with the Golgi membrane and dissociates from the membrane upon phosphorylation. Ras-associated protein 1 recruits this protein to coat protein complex II (COPII) vesicles during budding from the endoplasmic reticulum, where it interacts with a set of COPII vesicle-associated SNAREs to form a cis-SNARE complex that promotes targeting to the Golgi apparatus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit embryonic lethality between E3.5 and E8.5 with disruption of Golgi apparatus in blastocyst cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930505A04Rik	C	T	11: 30,426,349	V173M	probably damaging	Het
Acaca	G	T	11: 84,245,294	E492*	probably null	Het
Acp7	T	A	7: 28,616,543	K206M	probably benign	Het
Agbl1	T	A	7: 76,589,503	F584I	probably damaging	Het
Ahi1	A	G	10: 21,055,047	I929V	possibly damaging	Het
Ank3	G	A	10: 70,002,565	R1566K	possibly damaging	Het
Arhgef40	A	G	14: 52,000,900	I1279V	possibly damaging	Het
Arl14	A	C	3: 69,223,038	T173P	probably damaging	Het
Asap1	A	G	15: 64,312,453	S44P	probably damaging	Het
Btbd7	C	A	12: 102,785,197	A1103S	probably benign	Het
Capn10	T	A	1: 92,937,931		probably null	Het
Capn7	T	C	14: 31,369,802	F719L	probably benign	Het
Casp7	G	A	19: 56,440,982	D267N	probably benign	Het
Ccdc13	C	A	9: 121,814,290	K348N	probably damaging	Het
Chchd1	T	C	14: 20,703,110	F13L	probably benign	Het
Clcn6	T	A	4: 148,014,561	M442L	possibly damaging	Het
Col6a3	T	C	1: 90,827,880	E229G	probably benign	Het
Cyb5r3	A	G	15: 83,154,554	F278S	probably damaging	Het
Dhx16	C	T	17: 35,891,086	Q1002*	probably null	Het
Dppa4	T	C	16: 48,291,015	L121P	probably benign	Het
Dpyd	A	G	3: 118,917,092	E383G	probably damaging	Het
Eif4g3	A	G	4: 138,126,589	T489A	probably benign	Het
Elovl1	G	T	4: 118,431,635	V174L	probably damaging	Het
Elp3	T	C	14: 65,551,402	K392E	possibly damaging	Het
Fancd2os	C	A	6: 113,598,024	W7L	probably damaging	Het
Fchsd2	A	G	7: 101,110,784	T23A	possibly damaging	Het
Gabrp	C	G	11: 33,554,308	A336P	possibly damaging	Het
Gcm2	T	A	13: 41,109,911	Y15F	possibly damaging	Het
Gpr132	G	A	12: 112,852,796	R137C	probably damaging	Het
Herc1	A	G	9: 66,465,435	E3091G	probably damaging	Het
Homer1	A	T	13: 93,356,102	M184L	probably benign	Het
Izumo1r	T	C	9: 14,900,849	E117G	probably damaging	Het
Kcnt1	C	T	2: 25,901,909	Q590*	probably null	Het
Lama1	G	T	17: 67,770,987	C1139F	probably damaging	Het
Med29	C	T	7: 28,386,814	A190T	probably benign	Het
Mgea5	A	C	19: 45,776,997	S124A	probably benign	Het
Muc4	T	C	16: 32,750,782	V220A	probably benign	Het
Mxra8	G	T	4: 155,842,921	V388L	probably benign	Het
Myo5a	T	C	9: 75,144,181		probably null	Het
Myrip	A	G	9: 120,461,433	Y706C	probably damaging	Het
Nphp4	T	C	4: 152,506,485	V313A	probably benign	Het
Olfm2	T	G	9: 20,668,544		probably null	Het
Olfr1113	T	A	2: 87,213,728	S279T	probably benign	Het
Olfr248	T	C	1: 174,391,375	F102S	probably damaging	Het
Pcdh15	C	T	10: 74,626,788	P1398L	probably damaging	Het
Pdpr	A	G	8: 111,114,811	E225G	possibly damaging	Het
Pigs	C	A	11: 78,328,769		probably null	Het
Pkhd1	T	A	1: 20,588,531	T159S	probably damaging	Het
Plk4	A	G	3: 40,813,586	T87A	possibly damaging	Het
Plxna4	T	C	6: 32,215,722	Y768C	probably damaging	Het
Prl3d3	T	A	13: 27,159,081		probably null	Het
Pygb	T	C	2: 150,820,888		probably null	Het
Rnf114	T	C	2: 167,510,934	I118T	possibly damaging	Het
Sbno2	A	G	10: 80,058,453	L1099P	probably benign	Het
Scaper	T	C	9: 55,807,632	K791E	probably damaging	Het
Serping1	T	C	2: 84,771,545	T194A	probably damaging	Het
Slc12a9	A	G	5: 137,321,403	S617P	possibly damaging	Het
Slk	G	A	19: 47,636,457	R1039H	probably damaging	Het
Sntb1	T	A	15: 55,792,139	E227V	probably benign	Het
Sostdc1	C	A	12: 36,314,408	P39T	probably benign	Het
Spred1	C	T	2: 117,153,005	R16*	probably null	Het
Srpk2	A	G	5: 23,518,477	I547T	probably damaging	Het
Stt3a	A	G	9: 36,759,314	Y54H	probably damaging	Het
Stt3b	A	T	9: 115,266,147	L272H	probably damaging	Het
Syne2	T	A	12: 76,108,217		probably null	Het
Usp15	A	T	10: 123,130,987	L476*	probably null	Het
Vmn1r189	T	C	13: 22,102,166	Y167C	probably damaging	Het
Vmn2r24	A	G	6: 123,786,979	T272A	possibly damaging	Het
Vps13a	A	T	19: 16,668,690	H1994Q	probably damaging	Het
Zbtb10	T	C	3: 9,265,192	S537P	probably damaging	Het
Zbtb12	T	C	17: 34,895,883	S215P	possibly damaging	Het
Zfp346	T	C	13: 55,113,102	M81T	probably benign	Het
Zfp800	T	C	6: 28,244,513	D151G	probably null	Het

Other mutations in Uso1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01522:Uso1	APN	5	92181419	missense	probably damaging	0.96
IGL01753:Uso1	APN	5	92152918	critical splice donor site	probably null
IGL02311:Uso1	APN	5	92187776	missense	probably benign
IGL02539:Uso1	APN	5	92187773	missense	probably damaging	1.00
IGL02716:Uso1	APN	5	92173935	missense	probably damaging	0.99
IGL03154:Uso1	APN	5	92180618	nonsense	probably null
R0558:Uso1	UTSW	5	92174019	missense	probably benign	0.03
R0570:Uso1	UTSW	5	92199823	missense	probably benign	0.19
R1195:Uso1	UTSW	5	92170747	missense	probably damaging	1.00
R1195:Uso1	UTSW	5	92170747	missense	probably damaging	1.00
R1195:Uso1	UTSW	5	92170747	missense	probably damaging	1.00
R1398:Uso1	UTSW	5	92181468	missense	probably benign	0.16
R1485:Uso1	UTSW	5	92180563	missense	possibly damaging	0.76
R1813:Uso1	UTSW	5	92201133	critical splice acceptor site	probably null
R1873:Uso1	UTSW	5	92192859	splice site	probably benign
R1896:Uso1	UTSW	5	92201133	critical splice acceptor site	probably null
R1899:Uso1	UTSW	5	92201192	missense	probably benign	0.27
R2049:Uso1	UTSW	5	92181936	missense	probably damaging	1.00
R2128:Uso1	UTSW	5	92195370	missense	probably benign
R2411:Uso1	UTSW	5	92158399	splice site	probably benign
R2903:Uso1	UTSW	5	92195435	critical splice donor site	probably null
R5055:Uso1	UTSW	5	92192735	missense	probably benign	0.31
R5155:Uso1	UTSW	5	92167335	critical splice donor site	probably null
R5590:Uso1	UTSW	5	92180608	missense	probably benign	0.05
R5677:Uso1	UTSW	5	92201299	missense	probably damaging	1.00
R5996:Uso1	UTSW	5	92192730	missense	probably benign	0.00
R6165:Uso1	UTSW	5	92187267	missense	probably damaging	1.00
R6340:Uso1	UTSW	5	92199852	missense	probably benign	0.01
R6701:Uso1	UTSW	5	92166585	missense	probably damaging	1.00
R6860:Uso1	UTSW	5	92195348	missense	probably benign	0.11
R7062:Uso1	UTSW	5	92192740	missense	possibly damaging	0.62
R7133:Uso1	UTSW	5	92158465	missense	probably benign	0.12
R7317:Uso1	UTSW	5	92173992	missense	possibly damaging	0.70
R7527:Uso1	UTSW	5	92199875	missense	possibly damaging	0.58
R7648:Uso1	UTSW	5	92194002	splice site	probably null
R7707:Uso1	UTSW	5	92201936	makesense	probably null
R8009:Uso1	UTSW	5	92166580	missense	probably benign	0.03
R8104:Uso1	UTSW	5	92158421	missense	probably damaging	0.99
R8361:Uso1	UTSW	5	92189262	missense	probably null	0.00
R8519:Uso1	UTSW	5	92195363	missense	probably benign
R9052:Uso1	UTSW	5	92180563	missense	probably damaging	1.00
R9142:Uso1	UTSW	5	92187266	nonsense	probably null
R9221:Uso1	UTSW	5	92187314	missense	probably benign	0.38
R9492:Uso1	UTSW	5	92167332	missense	possibly damaging	0.77
R9642:Uso1	UTSW	5	92138108	missense	probably damaging	1.00
Z1177:Uso1	UTSW	5	92138130	missense	possibly damaging	0.92

Predicted Primers

PCR Primer
(F):5'- TCTCAGGAAGCAATAGGGATGC -3'
(R):5'- GAAACGGGATGTTACGCCAG -3'

Sequencing Primer
(F):5'- GCAATAGGGATGCATATATAGGTTTC -3'
(R):5'- GGATGTTACGCCAGTGAATTAACC -3'

Posted On

2017-12-01