Incidental Mutation 'R5665:Uso1'
ID501334
Institutional Source Beutler Lab
Gene Symbol Uso1
Ensembl Gene ENSMUSG00000029407
Gene NameUSO1 vesicle docking factor
SynonymsVdp, TAP, transcytosis associated protein p115
MMRRC Submission 043308-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5665 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location92137938-92202798 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 92198337 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 793 (E793V)
Ref Sequence ENSEMBL: ENSMUSP00000031355 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031355] [ENSMUST00000201642] [ENSMUST00000202155]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031355
AA Change: E793V

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000031355
Gene: ENSMUSG00000029407
AA Change: E793V

DomainStartEndE-ValueType
Blast:ARM 47 91 1e-18 BLAST
low complexity region 94 100 N/A INTRINSIC
Blast:ARM 155 195 2e-15 BLAST
Blast:ARM 300 342 3e-19 BLAST
Pfam:Uso1_p115_head 344 628 6.5e-72 PFAM
low complexity region 630 643 N/A INTRINSIC
low complexity region 661 672 N/A INTRINSIC
low complexity region 730 744 N/A INTRINSIC
Pfam:Uso1_p115_C 782 954 1.6e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122796
Predicted Effect probably benign
Transcript: ENSMUST00000201642
SMART Domains Protein: ENSMUSP00000144165
Gene: ENSMUSG00000029407

DomainStartEndE-ValueType
PDB:3GRL|A 1 52 5e-24 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000202155
SMART Domains Protein: ENSMUSP00000144592
Gene: ENSMUSG00000029407

DomainStartEndE-ValueType
Blast:ARM 47 91 1e-18 BLAST
low complexity region 94 100 N/A INTRINSIC
Blast:ARM 155 195 2e-15 BLAST
Blast:ARM 300 342 3e-19 BLAST
Pfam:Uso1_p115_head 344 628 5.7e-72 PFAM
low complexity region 630 643 N/A INTRINSIC
low complexity region 661 672 N/A INTRINSIC
Pfam:Uso1_p115_C 730 892 2.1e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202362
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a peripheral membrane protein which recycles between the cytosol and the Golgi apparatus during interphase. It is regulated by phosphorylation: dephosphorylated protein associates with the Golgi membrane and dissociates from the membrane upon phosphorylation. Ras-associated protein 1 recruits this protein to coat protein complex II (COPII) vesicles during budding from the endoplasmic reticulum, where it interacts with a set of COPII vesicle-associated SNAREs to form a cis-SNARE complex that promotes targeting to the Golgi apparatus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit embryonic lethality between E3.5 and E8.5 with disruption of Golgi apparatus in blastocyst cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
Acaca G T 11: 84,245,294 E492* probably null Het
Acp7 T A 7: 28,616,543 K206M probably benign Het
Agbl1 T A 7: 76,589,503 F584I probably damaging Het
Ahi1 A G 10: 21,055,047 I929V possibly damaging Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Arhgef40 A G 14: 52,000,900 I1279V possibly damaging Het
Arl14 A C 3: 69,223,038 T173P probably damaging Het
Asap1 A G 15: 64,312,453 S44P probably damaging Het
Btbd7 C A 12: 102,785,197 A1103S probably benign Het
Capn10 T A 1: 92,937,931 probably null Het
Capn7 T C 14: 31,369,802 F719L probably benign Het
Casp7 G A 19: 56,440,982 D267N probably benign Het
Ccdc13 C A 9: 121,814,290 K348N probably damaging Het
Chchd1 T C 14: 20,703,110 F13L probably benign Het
Clcn6 T A 4: 148,014,561 M442L possibly damaging Het
Col6a3 T C 1: 90,827,880 E229G probably benign Het
Cyb5r3 A G 15: 83,154,554 F278S probably damaging Het
Dhx16 C T 17: 35,891,086 Q1002* probably null Het
Dppa4 T C 16: 48,291,015 L121P probably benign Het
Dpyd A G 3: 118,917,092 E383G probably damaging Het
Eif4g3 A G 4: 138,126,589 T489A probably benign Het
Elovl1 G T 4: 118,431,635 V174L probably damaging Het
Elp3 T C 14: 65,551,402 K392E possibly damaging Het
Fancd2os C A 6: 113,598,024 W7L probably damaging Het
Fchsd2 A G 7: 101,110,784 T23A possibly damaging Het
Gabrp C G 11: 33,554,308 A336P possibly damaging Het
Gcm2 T A 13: 41,109,911 Y15F possibly damaging Het
Gpr132 G A 12: 112,852,796 R137C probably damaging Het
Herc1 A G 9: 66,465,435 E3091G probably damaging Het
Homer1 A T 13: 93,356,102 M184L probably benign Het
Izumo1r T C 9: 14,900,849 E117G probably damaging Het
Kcnt1 C T 2: 25,901,909 Q590* probably null Het
Lama1 G T 17: 67,770,987 C1139F probably damaging Het
Med29 C T 7: 28,386,814 A190T probably benign Het
Mgea5 A C 19: 45,776,997 S124A probably benign Het
Muc4 T C 16: 32,750,782 V220A probably benign Het
Mxra8 G T 4: 155,842,921 V388L probably benign Het
Myo5a T C 9: 75,144,181 probably null Het
Myrip A G 9: 120,461,433 Y706C probably damaging Het
Nphp4 T C 4: 152,506,485 V313A probably benign Het
Olfm2 T G 9: 20,668,544 probably null Het
Olfr1113 T A 2: 87,213,728 S279T probably benign Het
Olfr248 T C 1: 174,391,375 F102S probably damaging Het
Pcdh15 C T 10: 74,626,788 P1398L probably damaging Het
Pdpr A G 8: 111,114,811 E225G possibly damaging Het
Pigs C A 11: 78,328,769 probably null Het
Pkhd1 T A 1: 20,588,531 T159S probably damaging Het
Plk4 A G 3: 40,813,586 T87A possibly damaging Het
Plxna4 T C 6: 32,215,722 Y768C probably damaging Het
Prl3d3 T A 13: 27,159,081 probably null Het
Pygb T C 2: 150,820,888 probably null Het
Rnf114 T C 2: 167,510,934 I118T possibly damaging Het
Sbno2 A G 10: 80,058,453 L1099P probably benign Het
Scaper T C 9: 55,807,632 K791E probably damaging Het
Serping1 T C 2: 84,771,545 T194A probably damaging Het
Slc12a9 A G 5: 137,321,403 S617P possibly damaging Het
Slk G A 19: 47,636,457 R1039H probably damaging Het
Sntb1 T A 15: 55,792,139 E227V probably benign Het
Sostdc1 C A 12: 36,314,408 P39T probably benign Het
Spred1 C T 2: 117,153,005 R16* probably null Het
Srpk2 A G 5: 23,518,477 I547T probably damaging Het
Stt3a A G 9: 36,759,314 Y54H probably damaging Het
Stt3b A T 9: 115,266,147 L272H probably damaging Het
Syne2 T A 12: 76,108,217 probably null Het
Usp15 A T 10: 123,130,987 L476* probably null Het
Vmn1r189 T C 13: 22,102,166 Y167C probably damaging Het
Vmn2r24 A G 6: 123,786,979 T272A possibly damaging Het
Vps13a A T 19: 16,668,690 H1994Q probably damaging Het
Zbtb10 T C 3: 9,265,192 S537P probably damaging Het
Zbtb12 T C 17: 34,895,883 S215P possibly damaging Het
Zfp346 T C 13: 55,113,102 M81T probably benign Het
Zfp800 T C 6: 28,244,513 D151G probably null Het
Other mutations in Uso1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01522:Uso1 APN 5 92181419 missense probably damaging 0.96
IGL01753:Uso1 APN 5 92152918 critical splice donor site probably null
IGL02311:Uso1 APN 5 92187776 missense probably benign
IGL02539:Uso1 APN 5 92187773 missense probably damaging 1.00
IGL02716:Uso1 APN 5 92173935 missense probably damaging 0.99
IGL03154:Uso1 APN 5 92180618 nonsense probably null
R0558:Uso1 UTSW 5 92174019 missense probably benign 0.03
R0570:Uso1 UTSW 5 92199823 missense probably benign 0.19
R1195:Uso1 UTSW 5 92170747 missense probably damaging 1.00
R1195:Uso1 UTSW 5 92170747 missense probably damaging 1.00
R1195:Uso1 UTSW 5 92170747 missense probably damaging 1.00
R1398:Uso1 UTSW 5 92181468 missense probably benign 0.16
R1485:Uso1 UTSW 5 92180563 missense possibly damaging 0.76
R1813:Uso1 UTSW 5 92201133 critical splice acceptor site probably null
R1873:Uso1 UTSW 5 92192859 splice site probably benign
R1896:Uso1 UTSW 5 92201133 critical splice acceptor site probably null
R1899:Uso1 UTSW 5 92201192 missense probably benign 0.27
R2049:Uso1 UTSW 5 92181936 missense probably damaging 1.00
R2128:Uso1 UTSW 5 92195370 missense probably benign
R2411:Uso1 UTSW 5 92158399 splice site probably benign
R2903:Uso1 UTSW 5 92195435 critical splice donor site probably null
R5055:Uso1 UTSW 5 92192735 missense probably benign 0.31
R5155:Uso1 UTSW 5 92167335 critical splice donor site probably null
R5590:Uso1 UTSW 5 92180608 missense probably benign 0.05
R5677:Uso1 UTSW 5 92201299 missense probably damaging 1.00
R5996:Uso1 UTSW 5 92192730 missense probably benign 0.00
R6165:Uso1 UTSW 5 92187267 missense probably damaging 1.00
R6340:Uso1 UTSW 5 92199852 missense probably benign 0.01
R6701:Uso1 UTSW 5 92166585 missense probably damaging 1.00
R6860:Uso1 UTSW 5 92195348 missense probably benign 0.11
R7062:Uso1 UTSW 5 92192740 missense possibly damaging 0.62
R7133:Uso1 UTSW 5 92158465 missense probably benign 0.12
R7317:Uso1 UTSW 5 92173992 missense possibly damaging 0.70
R7527:Uso1 UTSW 5 92199875 missense possibly damaging 0.58
R7648:Uso1 UTSW 5 92194002 splice site probably null
R7707:Uso1 UTSW 5 92201936 makesense probably null
R8009:Uso1 UTSW 5 92166580 missense probably benign 0.03
R8104:Uso1 UTSW 5 92158421 missense probably damaging 0.99
R8361:Uso1 UTSW 5 92189262 missense probably null 0.00
R8519:Uso1 UTSW 5 92195363 missense probably benign
Z1177:Uso1 UTSW 5 92138130 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TCTCAGGAAGCAATAGGGATGC -3'
(R):5'- GAAACGGGATGTTACGCCAG -3'

Sequencing Primer
(F):5'- GCAATAGGGATGCATATATAGGTTTC -3'
(R):5'- GGATGTTACGCCAGTGAATTAACC -3'
Posted On2017-12-01