Incidental Mutation 'R5667:Lmbr1l'
List |< first << previous [record 35 of 54] next >> last >|
ID501345
Institutional Source Beutler Lab
Gene Symbol Lmbr1l
Ensembl Gene ENSMUSG00000022999
Gene Namelimb region 1 like
Synonyms1110013E13Rik, D15Ertd735e
MMRRC Submission 043310-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5667 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location98903917-98918231 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 98907608 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 337 (D337E)
Ref Sequence ENSEMBL: ENSMUSP00000023736 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023736] [ENSMUST00000109127]
Predicted Effect possibly damaging
Transcript: ENSMUST00000023736
AA Change: D337E

PolyPhen 2 Score 0.875 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000023736
Gene: ENSMUSG00000022999
AA Change: D337E

DomainStartEndE-ValueType
Pfam:LMBR1 28 269 2e-41 PFAM
Pfam:LMBR1 266 450 1.2e-35 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000109127
SMART Domains Protein: ENSMUSP00000104755
Gene: ENSMUSG00000022999

DomainStartEndE-ValueType
Pfam:LMBR1 1 324 6.3e-110 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123950
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127548
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135051
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231087
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 96% (54/56)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene disruption display normal morphology, clinical chemistry, hematology, and behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
4930444G20Rik T A 10: 22,066,843 T413S possibly damaging Het
4932438A13Rik A T 3: 36,917,677 T520S probably benign Het
Adamts16 A T 13: 70,836,375 Y56* probably null Het
Ak2 T A 4: 129,008,247 F238I probably damaging Het
Akap8l T C 17: 32,338,292 Y115C probably damaging Het
Alms1 A G 6: 85,696,771 D3116G probably damaging Het
Arhgap24 T G 5: 102,846,171 probably null Het
Arhgap45 A G 10: 80,025,476 E491G probably damaging Het
Atp8b1 C T 18: 64,581,923 C86Y probably damaging Het
Atxn1 T C 13: 45,557,377 K693R probably benign Het
BC003965 G A 17: 25,184,989 S101N probably damaging Het
Btbd10 T C 7: 113,332,724 K165R probably damaging Het
Capn11 C T 17: 45,639,674 R293Q possibly damaging Het
Chordc1 T G 9: 18,295,332 F33V probably damaging Het
Clca4b G A 3: 144,921,863 T449I probably benign Het
Clip4 A C 17: 71,789,883 M1L probably damaging Het
Cyfip1 C T 7: 55,873,730 T90I probably benign Het
Cyp4v3 G T 8: 45,308,535 T417K possibly damaging Het
D430042O09Rik T A 7: 125,843,455 probably null Het
Exoc3l4 T C 12: 111,423,417 I142T probably damaging Het
Flnb T A 14: 7,890,843 I575N probably benign Het
Foxa1 A T 12: 57,542,295 S380T probably benign Het
Foxi2 A T 7: 135,410,939 probably null Het
Gad1-ps A T 10: 99,444,533 noncoding transcript Het
Gpa33 A G 1: 166,146,791 T66A possibly damaging Het
Gpr45 A G 1: 43,033,058 Y287C probably damaging Het
H2-Eb1 C A 17: 34,314,255 Y150* probably null Het
H2-Ke6 T C 17: 34,026,461 D233G probably null Het
Ifna6 A T 4: 88,827,669 Q85L probably damaging Het
Ivns1abp G T 1: 151,354,009 L149F probably benign Het
Kank4 A G 4: 98,765,461 probably null Het
Lama2 A T 10: 27,190,544 C1114S probably damaging Het
Lrrn3 A C 12: 41,452,298 S673R possibly damaging Het
Ly75 T C 2: 60,308,311 D1404G probably damaging Het
Muc4 A G 16: 32,753,720 T1199A probably benign Het
Mycn A T 12: 12,940,044 M117K possibly damaging Het
Nalcn A G 14: 123,295,406 I1314T probably damaging Het
Nod1 T C 6: 54,933,576 T869A probably benign Het
Olfr1285 C T 2: 111,408,473 noncoding transcript Het
Olfr1388 T C 11: 49,444,313 V154A probably benign Het
Plekhg2 A T 7: 28,367,639 I356N probably damaging Het
Ptpru T A 4: 131,820,190 Y112F possibly damaging Het
Rpl36al G A 12: 69,183,123 P5L possibly damaging Het
Ryr2 A G 13: 11,759,836 W1145R probably damaging Het
Slc11a2 A G 15: 100,403,288 Y295H probably damaging Het
Slc22a6 A G 19: 8,621,784 probably null Het
Styxl1 A G 5: 135,757,123 probably null Het
Tmc6 A G 11: 117,775,615 S288P possibly damaging Het
Trpv4 A G 5: 114,634,556 L371P probably damaging Het
Usp8 A G 2: 126,742,425 D518G probably benign Het
Washc4 T C 10: 83,570,028 S463P probably damaging Het
Other mutations in Lmbr1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02002:Lmbr1l APN 15 98904785 missense probably damaging 1.00
IGL02097:Lmbr1l APN 15 98917891 missense probably damaging 0.98
IGL02731:Lmbr1l APN 15 98917896 missense probably damaging 0.96
Gooseberry UTSW 15 98912427 missense probably damaging 0.99
morula UTSW 15 98904791 missense probably damaging 1.00
strawberry UTSW 15 98909263 nonsense probably null
R0310:Lmbr1l UTSW 15 98908773 splice site probably benign
R1778:Lmbr1l UTSW 15 98912476 missense probably damaging 1.00
R2418:Lmbr1l UTSW 15 98907537 missense possibly damaging 0.89
R2419:Lmbr1l UTSW 15 98907537 missense possibly damaging 0.89
R4181:Lmbr1l UTSW 15 98908720 missense possibly damaging 0.94
R4379:Lmbr1l UTSW 15 98909263 nonsense probably null
R4472:Lmbr1l UTSW 15 98906297 missense probably benign 0.02
R5290:Lmbr1l UTSW 15 98912242 missense probably damaging 1.00
R5410:Lmbr1l UTSW 15 98909262 missense probably damaging 1.00
R5436:Lmbr1l UTSW 15 98904791 missense probably damaging 1.00
R5671:Lmbr1l UTSW 15 98907608 missense possibly damaging 0.88
R5918:Lmbr1l UTSW 15 98912427 missense probably damaging 0.99
R6735:Lmbr1l UTSW 15 98909240 missense probably damaging 1.00
R6882:Lmbr1l UTSW 15 98907586 missense probably damaging 0.99
R7131:Lmbr1l UTSW 15 98906323 missense probably benign 0.05
R7136:Lmbr1l UTSW 15 98911491 splice site probably null
R7169:Lmbr1l UTSW 15 98909158 frame shift probably null
R7169:Lmbr1l UTSW 15 98909194 critical splice donor site probably benign
R7336:Lmbr1l UTSW 15 98913587 missense possibly damaging 0.94
R7541:Lmbr1l UTSW 15 98909386 critical splice donor site probably null
R7603:Lmbr1l UTSW 15 98908691 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAGATATGTGGCTGCCCTG -3'
(R):5'- TGTTAGCCCACCTGAAGCAG -3'

Sequencing Primer
(F):5'- ATATGTGGCTGCCCTGGTCTC -3'
(R):5'- AGAAGGCTGGATGGTCCTGGTGTTC -3'
Posted On2017-12-01