Mutagenetix > Incidental Mutation

Incidental Mutation 'R5696:Afg3l2'

501356

Institutional Source

Beutler Lab

Gene Symbol

Afg3l2

Ensembl Gene

ENSMUSG00000024527

Gene Name

AFG3-like AAA ATPase 2

Synonyms

2310036I02Rik, Emv66, par

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5696 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

67404767-67449166 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 67407459 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 660 (I660T)

Ref Sequence

ENSEMBL: ENSMUSP00000025408 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000001513] [ENSMUST00000025408]

AlphaFold

Q8JZQ2

Predicted Effect

probably benign
Transcript: ENSMUST00000001513

SMART Domains

Protein: ENSMUSP00000001513
Gene: ENSMUSG00000001473

Domain	Start	End	E-Value	Type
Tubulin	47	244	6.2e-66	SMART
Tubulin_C	246	383	3.57e-48	SMART
low complexity region	432	447	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000025408
AA Change: I660T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000025408
Gene: ENSMUSG00000024527
AA Change: I660T

Domain	Start	End	E-Value	Type
low complexity region	95	121	N/A	INTRINSIC
Pfam:FtsH_ext	144	241	8.8e-12	PFAM
transmembrane domain	251	270	N/A	INTRINSIC
low complexity region	271	286	N/A	INTRINSIC
AAA	339	478	1.37e-23	SMART
Pfam:Peptidase_M41	540	743	4e-77	PFAM
low complexity region	780	794	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein localized in mitochondria and closely related to paraplegin. The paraplegin gene is responsible for an autosomal recessive form of hereditary spastic paraplegia. This gene is a candidate gene for other hereditary spastic paraplegias or neurodegenerative disorders. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for mutations in this gene usually die before weaning. Mice develop progressive paralysis as a result of abnormalities in the axons innervating muscle endplates. Mice homozygous for a conditional allele activated in Purkinje cells exhibit abnormal gait and Purkinje cell degeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam8	G	A	7: 139,989,246	R186W	probably benign	Het
Amtn	T	A	5: 88,385,085	Y186*	probably null	Het
Atrip	A	G	9: 109,065,501	S453P	possibly damaging	Het
Bahcc1	T	C	11: 120,273,987	L840P	probably damaging	Het
Capn2	T	C	1: 182,478,600	E527G	possibly damaging	Het
Caprin2	A	T	6: 148,877,818	Y164N	possibly damaging	Het
Ccnh	T	A	13: 85,196,327		probably null	Het
Cdon	G	T	9: 35,491,866	V1091F	possibly damaging	Het
Ceacam14	A	G	7: 17,814,342	Y119C	probably damaging	Het
Ces2h	A	G	8: 105,018,979	K445E	possibly damaging	Het
Cfap46	A	G	7: 139,612,031	S2357P	probably damaging	Het
Commd4	A	T	9: 57,156,215	S86R	possibly damaging	Het
Cpsf6	A	T	10: 117,361,029		probably benign	Het
Dag1	A	T	9: 108,209,447	V165E	probably benign	Het
Dmxl1	A	T	18: 49,931,941	K2618*	probably null	Het
Dnah17	A	G	11: 118,101,056	Y1229H	probably benign	Het
Endov	T	A	11: 119,491,799	L24Q	probably damaging	Het
Fam214a	A	G	9: 75,010,117	E666G	probably benign	Het
Fap	C	T	2: 62,502,459	V717M	probably damaging	Het
Fbxl2	A	G	9: 113,986,478	L239P	probably damaging	Het
Fbxl5	A	T	5: 43,758,840	V367D	possibly damaging	Het
Fkbp10	G	T	11: 100,423,526	W384L	probably damaging	Het
Gbp8	C	T	5: 105,018,816	V216I	possibly damaging	Het
Gclm	G	A	3: 122,266,287	A239T	probably benign	Het
Gm11569	C	T	11: 99,798,730		probably benign	Het
Gm14124	C	T	2: 150,269,474	H695Y	possibly damaging	Het
Gnas	C	A	2: 174,299,675		probably benign	Het
Grb10	T	A	11: 11,933,566	N508I	probably benign	Het
Gykl1	T	G	18: 52,694,195	I158M	probably benign	Het
Ide	G	A	19: 37,318,021	T214M	unknown	Het
Il12rb2	T	A	6: 67,295,278	Q341H	possibly damaging	Het
Ints1	T	C	5: 139,754,989	E1946G	probably benign	Het
Kdelr3	T	C	15: 79,525,899		probably null	Het
Kif1b	A	C	4: 149,273,849		probably null	Het
Kri1	A	G	9: 21,280,237	I320T	probably damaging	Het
Krt9	TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC	TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC	11: 100,189,077		probably benign	Het
Lin9	T	C	1: 180,659,081	S111P	probably benign	Het
Lpcat2b	C	A	5: 107,432,907	P34Q	probably damaging	Het
Ltk	T	A	2: 119,759,599	T49S	probably benign	Het
Map3k9	A	T	12: 81,734,122	H421Q	probably benign	Het
Mapkbp1	T	A	2: 120,021,720		probably null	Het
Mcm4	A	G	16: 15,625,570	S830P	probably damaging	Het
Nek10	T	A	14: 14,860,736		probably null	Het
Nlrp9b	A	T	7: 20,024,492	R551S	probably benign	Het
Nol4l	T	C	2: 153,418,106	T143A	probably damaging	Het
Olfr1346	T	C	7: 6,474,743		probably null	Het
Olfr1355	A	T	10: 78,880,085	R304S	probably benign	Het
Olfr398	T	C	11: 73,984,536	H24R	possibly damaging	Het
Olfr578	T	A	7: 102,984,541	T208S	probably benign	Het
Pde4dip	G	T	3: 97,709,490	A1812D	probably damaging	Het
Plekhb1	C	A	7: 100,656,753	G26C	probably damaging	Het
Polr1a	T	A	6: 71,929,426	F409I	probably benign	Het
Ptpn13	T	A	5: 103,554,759	M1197K	probably benign	Het
Qrich2	T	C	11: 116,445,002	I2114V	probably damaging	Het
Rbm27	T	C	18: 42,317,666	Y449H	probably damaging	Het
Rp1l1	A	G	14: 64,029,746	D927G	probably damaging	Het
Secisbp2	C	A	13: 51,679,821	Q666K	probably damaging	Het
Slc45a2	T	C	15: 11,001,133	I106T	probably damaging	Het
Slx4	G	T	16: 3,979,967	Q1518K	probably damaging	Het
Smim10l1	T	C	6: 133,105,526	F12S	probably damaging	Het
Son	T	C	16: 91,671,413	V306A	possibly damaging	Het
Stab1	A	G	14: 31,160,221	S506P	probably benign	Het
Syne2	A	C	12: 75,994,145	D3859A	probably benign	Het
Tab1	T	A	15: 80,148,729	Y71*	probably null	Het
Tarbp1	A	C	8: 126,447,340	M909R	probably damaging	Het
Tex15	T	G	8: 33,573,192	S1157R	probably benign	Het
Tnni3	G	A	7: 4,520,454	T120I	probably benign	Het
Ttn	T	C	2: 76,917,544	E4387G	probably benign	Het
Ugt3a2	G	A	15: 9,361,448		silent	Het
Unc5d	T	C	8: 28,666,842	I783V	probably benign	Het
Usp40	T	C	1: 87,995,752	T266A	probably benign	Het
Vmn2r59	C	T	7: 42,046,044	V315I	probably benign	Het
Zbtb48	G	T	4: 152,020,610	H532N	probably damaging	Het

Other mutations in Afg3l2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00962:Afg3l2	APN	18	67431653	critical splice donor site	probably null
IGL01395:Afg3l2	APN	18	67442810	missense	probably benign	0.21
IGL01533:Afg3l2	APN	18	67405418	nonsense	probably null
IGL01814:Afg3l2	APN	18	67405474	missense	probably benign	0.23
IGL01868:Afg3l2	APN	18	67414148	missense	possibly damaging	0.83
IGL02399:Afg3l2	APN	18	67429040	missense	possibly damaging	0.82
IGL02827:Afg3l2	APN	18	67425945	missense	probably damaging	1.00
IGL03342:Afg3l2	APN	18	67407320	missense	probably benign
IGL03392:Afg3l2	APN	18	67414069	splice site	probably benign
radicle	UTSW	18	67422953	missense	probably damaging	1.00
rootlet	UTSW	18	67421259	missense	probably damaging	1.00
R0057:Afg3l2	UTSW	18	67423086	missense	probably damaging	1.00
R0107:Afg3l2	UTSW	18	67431766	missense	probably damaging	1.00
R0650:Afg3l2	UTSW	18	67415557	missense	possibly damaging	0.77
R0831:Afg3l2	UTSW	18	67421227	missense	probably damaging	1.00
R0899:Afg3l2	UTSW	18	67422977	missense	possibly damaging	0.65
R0962:Afg3l2	UTSW	18	67405427	missense	possibly damaging	0.77
R1672:Afg3l2	UTSW	18	67407423	missense	probably benign	0.31
R1815:Afg3l2	UTSW	18	67415573	nonsense	probably null
R1838:Afg3l2	UTSW	18	67414172	missense	probably damaging	0.99
R2013:Afg3l2	UTSW	18	67431772	missense	probably damaging	0.99
R2383:Afg3l2	UTSW	18	67422956	missense	possibly damaging	0.91
R2906:Afg3l2	UTSW	18	67440222	missense	probably damaging	1.00
R4763:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R4765:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R4775:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5193:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5196:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5197:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5257:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5361:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5362:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5363:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5397:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5588:Afg3l2	UTSW	18	67440207	missense	possibly damaging	0.88
R5605:Afg3l2	UTSW	18	67442355	nonsense	probably null
R5722:Afg3l2	UTSW	18	67440199	missense	probably benign	0.44
R5779:Afg3l2	UTSW	18	67440443	missense	probably null	0.12
R5972:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5973:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5974:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5979:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5994:Afg3l2	UTSW	18	67429070	missense	probably damaging	1.00
R6026:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6027:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6028:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6029:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6033:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6033:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6035:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6035:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6075:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6077:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6081:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6131:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6132:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6134:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6152:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6154:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6169:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6178:Afg3l2	UTSW	18	67409528	missense	possibly damaging	0.91
R6187:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6216:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6718:Afg3l2	UTSW	18	67421276	missense	probably damaging	1.00
R7388:Afg3l2	UTSW	18	67422953	missense	probably damaging	1.00
R8479:Afg3l2	UTSW	18	67448916	missense	probably benign	0.05
R8531:Afg3l2	UTSW	18	67407369	missense	probably damaging	0.99
R9017:Afg3l2	UTSW	18	67409480	missense	possibly damaging	0.81
R9220:Afg3l2	UTSW	18	67429196	missense	probably benign
R9222:Afg3l2	UTSW	18	67434187	missense	probably benign	0.05
R9371:Afg3l2	UTSW	18	67434192	missense	possibly damaging	0.84
R9381:Afg3l2	UTSW	18	67442381	missense	probably damaging	1.00
R9562:Afg3l2	UTSW	18	67421295	missense	probably damaging	1.00
Z1176:Afg3l2	UTSW	18	67431707	missense	probably benign	0.44

Predicted Primers

PCR Primer
(F):5'- GAGGCTCATCTGTATGCAGG -3'
(R):5'- TTCACTCCCCTCACAGGTAGAG -3'

Sequencing Primer
(F):5'- ATCTGTATGCAGGCACGTAC -3'
(R):5'- CCTCACAGGTAGAGAAGTCTTCG -3'

Posted On

2017-12-01