Incidental Mutation 'R5700:Ston1'
ID501362
Institutional Source Beutler Lab
Gene Symbol Ston1
Ensembl Gene ENSMUSG00000033855
Gene Namestonin 1
Synonyms
MMRRC Submission 043328-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.167) question?
Stock #R5700 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location88597684-88662586 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 88644339 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 639 (S639R)
Ref Sequence ENSEMBL: ENSMUSP00000131703 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064035] [ENSMUST00000150023] [ENSMUST00000163588]
Predicted Effect probably damaging
Transcript: ENSMUST00000064035
AA Change: S639R

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000067027
Gene: ENSMUSG00000033855
AA Change: S639R

DomainStartEndE-ValueType
low complexity region 50 65 N/A INTRINSIC
low complexity region 132 143 N/A INTRINSIC
low complexity region 380 391 N/A INTRINSIC
Pfam:Adap_comp_sub 396 707 5.5e-64 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000150023
AA Change: S639R

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000122928
Gene: ENSMUSG00000033855
AA Change: S639R

DomainStartEndE-ValueType
low complexity region 50 65 N/A INTRINSIC
low complexity region 132 143 N/A INTRINSIC
low complexity region 380 391 N/A INTRINSIC
Pfam:Adap_comp_sub 396 707 5.5e-64 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153613
Predicted Effect probably damaging
Transcript: ENSMUST00000163588
AA Change: S639R

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000131703
Gene: ENSMUSG00000033855
AA Change: S639R

DomainStartEndE-ValueType
low complexity region 50 65 N/A INTRINSIC
low complexity region 132 143 N/A INTRINSIC
low complexity region 380 391 N/A INTRINSIC
Pfam:Adap_comp_sub 396 711 2.1e-64 PFAM
Meta Mutation Damage Score 0.1878 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Endocytosis of cell surface proteins is mediated by a complex molecular machinery that assembles on the inner surface of the plasma membrane. This gene encodes one of two human homologs of the Drosophila melanogaster stoned B protein. This protein is related to components of the endocytic machinery and exhibits a modular structure consisting of an N-terminal proline-rich domain, a central region of homology specific to the human stoned B-like proteins, and a C-terminal region homologous to the mu subunits of adaptor protein (AP) complexes. Read-through transcription of this gene into the neighboring downstream gene, which encodes TFIIA-alpha/beta-like factor, generates a transcript (SALF), which encodes a fusion protein comprised of sequence sharing identity with each individual gene product. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2010]
PHENOTYPE: Mice homozygous for a knock-out allele are overtly normal. Mouse embryonic fibroblasts derived from homozygous null mice display alterations in focal adhesion dynamics and an increase in cellular signaling and directional cell migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 A T 19: 43,798,194 Q155L probably benign Het
Acadvl A C 11: 70,013,203 Y242D probably damaging Het
Armc8 A G 9: 99,496,149 probably null Het
Barx2 A T 9: 31,858,765 F156I probably damaging Het
Best1 T C 19: 9,997,199 probably benign Het
Btbd8 T C 5: 107,503,648 S136P possibly damaging Het
Btla T A 16: 45,250,573 Y298* probably null Het
Casr T A 16: 36,509,617 I452F probably damaging Het
Ccser1 C A 6: 61,311,276 P141H probably benign Het
Cr2 A G 1: 195,159,757 V296A probably damaging Het
Csl T A 10: 99,759,015 I63F probably damaging Het
Dbt G A 3: 116,520,303 V40M probably damaging Het
Fam53b A T 7: 132,760,020 L93Q probably damaging Het
Fdps T C 3: 89,095,649 I105V probably damaging Het
Gm4884 A G 7: 41,043,219 D204G probably benign Het
Gm5592 A G 7: 41,158,579 probably benign Het
Gm7367 A T 7: 60,155,762 noncoding transcript Het
Grid2 T A 6: 64,094,432 V413D possibly damaging Het
Hgf C T 5: 16,610,124 P471L probably damaging Het
Hoxc9 T C 15: 102,981,881 Y77H possibly damaging Het
Hs6st3 C T 14: 119,138,787 R125* probably null Het
Kdm4b T C 17: 56,351,700 I15T possibly damaging Het
Klhl1 T C 14: 96,518,040 N93S probably benign Het
Klhl6 G A 16: 19,957,218 Q197* probably null Het
Medag T C 5: 149,422,217 V7A probably benign Het
Mptx2 G A 1: 173,274,847 L92F probably benign Het
Nckap5 C T 1: 125,976,925 probably null Het
Obscn T C 11: 59,133,194 K550R probably benign Het
Olfr1369-ps1 T A 13: 21,116,001 V103E probably damaging Het
Olfr193 T A 16: 59,109,993 I206F probably damaging Het
Olfr716 A G 7: 107,147,541 N75S probably benign Het
Olfr8 T C 10: 78,955,484 I93T probably damaging Het
Parp6 T C 9: 59,624,727 S101P probably damaging Het
Plcd3 T C 11: 103,073,763 N594S probably benign Het
Plscr5 A T 9: 92,205,511 K178* probably null Het
Ppp2r1b T C 9: 50,878,157 Y443H probably damaging Het
Pqlc2 C T 4: 139,300,254 S259N probably damaging Het
Prnd G A 2: 131,953,343 V128I probably benign Het
Rftn1 G T 17: 50,002,669 P156Q probably damaging Het
Scmh1 T C 4: 120,516,946 V445A probably benign Het
Serpinb6c A T 13: 33,899,308 M41K probably damaging Het
Spns1 A G 7: 126,372,469 V303A possibly damaging Het
Thbs4 T C 13: 92,776,953 D153G probably benign Het
Timm44 T C 8: 4,274,171 Y36C probably damaging Het
Trim34b G T 7: 104,336,411 V418F probably damaging Het
Vmn1r72 C T 7: 11,670,423 V33M probably damaging Het
Zcchc7 T C 4: 44,931,084 V412A probably benign Het
Zfand1 T A 3: 10,341,019 N210I probably damaging Het
Zfhx3 A G 8: 108,933,867 H1251R probably damaging Het
Other mutations in Ston1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01092:Ston1 APN 17 88644443 missense probably benign 0.00
IGL01593:Ston1 APN 17 88637010 missense probably null 1.00
FR4449:Ston1 UTSW 17 88635525 missense probably benign 0.38
R0610:Ston1 UTSW 17 88635281 missense possibly damaging 0.49
R1421:Ston1 UTSW 17 88635793 missense probably benign 0.02
R1620:Ston1 UTSW 17 88635816 missense probably benign 0.01
R2002:Ston1 UTSW 17 88635529 missense probably benign 0.01
R3108:Ston1 UTSW 17 88636155 nonsense probably null
R3766:Ston1 UTSW 17 88635360 missense probably damaging 1.00
R4222:Ston1 UTSW 17 88636771 missense probably damaging 1.00
R4335:Ston1 UTSW 17 88635697 missense probably damaging 1.00
R4355:Ston1 UTSW 17 88637008 missense probably damaging 1.00
R4867:Ston1 UTSW 17 88635694 missense probably damaging 1.00
R4902:Ston1 UTSW 17 88645252 missense probably damaging 0.99
R5084:Ston1 UTSW 17 88636574 missense probably benign 0.00
R5434:Ston1 UTSW 17 88645311 utr 3 prime probably benign
R5858:Ston1 UTSW 17 88635631 missense possibly damaging 0.93
R5863:Ston1 UTSW 17 88635945 missense possibly damaging 0.64
R6458:Ston1 UTSW 17 88635303 missense probably benign 0.14
R6459:Ston1 UTSW 17 88636468 missense probably benign 0.16
R7012:Ston1 UTSW 17 88635985 missense probably damaging 1.00
R7466:Ston1 UTSW 17 88635901 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CAGTGATGATACAGGCATACAGTG -3'
(R):5'- CCTGATTTGAACCAGGGTGC -3'

Sequencing Primer
(F):5'- GTGATAATAGATTTTAGAGCTGCTGG -3'
(R):5'- TTGTAGCAAGCTCGCTGACAC -3'
Posted On2017-12-01