Incidental Mutation 'R5739:Zfyve1'
ID501368
Institutional Source Beutler Lab
Gene Symbol Zfyve1
Ensembl Gene ENSMUSG00000042628
Gene Namezinc finger, FYVE domain containing 1
Synonyms
MMRRC Submission 043351-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5739 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location83546558-83597222 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 83575136 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 162 (V162L)
Ref Sequence ENSEMBL: ENSMUSP00000152501 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048319] [ENSMUST00000221919]
Predicted Effect possibly damaging
Transcript: ENSMUST00000048319
AA Change: V162L

PolyPhen 2 Score 0.613 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000042224
Gene: ENSMUSG00000042628
AA Change: V162L

DomainStartEndE-ValueType
low complexity region 429 436 N/A INTRINSIC
FYVE 590 660 8.36e-13 SMART
FYVE 707 776 1.15e-10 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000221919
AA Change: V162L

PolyPhen 2 Score 0.613 (Sensitivity: 0.87; Specificity: 0.91)
Meta Mutation Damage Score 0.0858 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 100% (82/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The FYVE domain mediates the recruitment of proteins involved in membrane trafficking and cell signaling to phosphatidylinositol 3-phosphate-containing membranes. This protein contains two zinc-binding FYVE domains in tandem and is reported to localize to the Golgi apparatus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190002N15Rik A T 9: 94,520,541 V356E possibly damaging Het
4931429L15Rik A T 9: 46,309,419 S50T probably benign Het
A930011G23Rik A G 5: 99,221,430 L529P probably damaging Het
Acer2 A T 4: 86,900,555 N147Y probably damaging Het
Adamtsl1 A G 4: 86,232,664 E353G probably damaging Het
Alg6 T C 4: 99,744,500 F60L probably benign Het
Ano6 A T 15: 95,913,379 D120V probably damaging Het
Armc3 A G 2: 19,253,917 D265G possibly damaging Het
Arntl G A 7: 113,285,031 R92Q probably damaging Het
Aurkc A T 7: 7,002,860 Y249F probably benign Het
Cacna2d2 A G 9: 107,512,329 I274V probably benign Het
Camk2n2 C A 16: 20,621,080 G39C probably damaging Het
Ccdc39 A G 3: 33,826,561 L419P possibly damaging Het
Cdh23 T C 10: 60,305,609 M3117V probably damaging Het
Celsr3 A G 9: 108,827,158 E280G probably benign Het
Cherp TGCTGGTGGTGGGG TG 8: 72,467,815 probably benign Het
Clcn6 A G 4: 148,014,189 V494A probably damaging Het
Col19a1 C T 1: 24,337,915 G450S probably damaging Het
Crb2 T G 2: 37,793,654 V1056G probably damaging Het
Crtac1 A G 19: 42,302,173 F363S probably damaging Het
Dnaaf2 T C 12: 69,196,941 S449G probably benign Het
Dnah7b A T 1: 46,233,992 I2427F probably damaging Het
Dnah8 T A 17: 30,719,007 D1619E probably benign Het
Dock3 A T 9: 106,973,796 S836T possibly damaging Het
Donson A T 16: 91,681,229 probably null Het
Drc3 G A 11: 60,375,130 R215H possibly damaging Het
Entpd2 T C 2: 25,399,492 S329P possibly damaging Het
Eya2 T C 2: 165,761,937 S332P probably damaging Het
Fam83f T A 15: 80,692,005 Y286N probably damaging Het
Fat4 T C 3: 38,983,134 V3645A probably benign Het
G2e3 T C 12: 51,372,504 F668L possibly damaging Het
Gm14403 T A 2: 177,509,247 C329S probably damaging Het
Hmcn1 G A 1: 150,808,697 T374I probably benign Het
Hmcn1 A T 1: 150,758,474 probably null Het
Hrnr T C 3: 93,323,129 S225P unknown Het
Ifi202b C T 1: 173,971,352 probably null Het
Il10ra A T 9: 45,256,070 D394E possibly damaging Het
Itga2b A T 11: 102,465,909 D275E probably benign Het
Jaml A T 9: 45,088,728 D108V probably damaging Het
Kir3dl1 G A X: 136,526,482 D56N probably damaging Het
Lrrtm1 T C 6: 77,244,889 V443A probably damaging Het
Mkln1 T A 6: 31,496,702 S126R probably benign Het
Myo19 T C 11: 84,897,624 I354T probably damaging Het
Nucb1 A T 7: 45,501,660 L99Q probably damaging Het
Olfr1312 A G 2: 112,042,783 F83S probably damaging Het
Pask A G 1: 93,322,056 S541P probably benign Het
Pdpr A T 8: 111,134,620 I749F possibly damaging Het
Phyhipl T C 10: 70,559,569 D269G possibly damaging Het
Pkdcc A G 17: 83,215,794 D110G probably benign Het
Ppox A G 1: 171,279,996 L115P probably damaging Het
Ppp1r12c A G 7: 4,497,282 L94P probably damaging Het
Ppp6r2 T A 15: 89,259,073 M141K probably benign Het
Prl3d1 A T 13: 27,100,012 H188L probably benign Het
Psmb3 T A 11: 97,713,470 probably benign Het
Pxdn T A 12: 29,982,334 S150T probably benign Het
Ripor3 T C 2: 167,981,283 T903A probably damaging Het
Rnase4 T C 14: 51,104,849 L10S probably benign Het
Rnf224 T C 2: 25,236,000 T114A probably benign Het
Rp1l1 A T 14: 64,032,170 E1735V probably benign Het
Rrp1b T A 17: 32,045,976 Y60N probably damaging Het
Rsbn1l A T 5: 20,905,816 V508E probably damaging Het
Rubcnl T C 14: 75,040,941 probably null Het
Rxfp4 A G 3: 88,651,902 probably benign Het
Sdccag8 A G 1: 176,826,231 T85A probably benign Het
Slc46a1 A T 11: 78,467,149 I343F possibly damaging Het
Ssh2 A G 11: 77,449,813 D597G probably damaging Het
Syne2 T A 12: 75,997,465 V3942E possibly damaging Het
Timd4 T C 11: 46,817,746 S200P probably benign Het
Tmc5 G A 7: 118,666,611 probably null Het
Tmem8 T A 17: 26,120,451 F580I probably damaging Het
Trbv16 A G 6: 41,152,079 T66A probably benign Het
Ttc3 A T 16: 94,439,324 K1103* probably null Het
Ttc7b A G 12: 100,384,233 V458A probably damaging Het
Ubxn10 A G 4: 138,720,823 S181P probably benign Het
Vmn2r11 A G 5: 109,059,248 probably null Het
Vmn2r26 A T 6: 124,025,966 N112Y probably benign Het
Vmn2r5 T C 3: 64,504,076 D357G probably damaging Het
Zc3h10 T C 10: 128,544,801 N229S probably benign Het
Zfp407 T C 18: 84,208,742 *2247W probably null Het
Other mutations in Zfyve1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Zfyve1 APN 12 83574798 missense probably benign 0.09
IGL00475:Zfyve1 APN 12 83555711 critical splice acceptor site probably null
IGL01291:Zfyve1 APN 12 83555005 missense probably benign 0.04
IGL01380:Zfyve1 APN 12 83552507 missense probably damaging 1.00
IGL02037:Zfyve1 APN 12 83547920 missense probably damaging 1.00
IGL02184:Zfyve1 APN 12 83558693 missense probably benign 0.29
IGL02619:Zfyve1 APN 12 83550944 unclassified probably benign
IGL03031:Zfyve1 APN 12 83574821 missense probably damaging 0.99
IGL03105:Zfyve1 APN 12 83558639 missense probably damaging 1.00
sasso UTSW 12 83575056 missense probably damaging 1.00
ANU05:Zfyve1 UTSW 12 83555005 missense probably benign 0.04
R0123:Zfyve1 UTSW 12 83555073 splice site probably benign
R0225:Zfyve1 UTSW 12 83555073 splice site probably benign
R0468:Zfyve1 UTSW 12 83555274 splice site probably benign
R1218:Zfyve1 UTSW 12 83548051 missense possibly damaging 0.79
R1896:Zfyve1 UTSW 12 83555614 missense probably damaging 0.99
R2291:Zfyve1 UTSW 12 83547931 missense probably damaging 0.99
R4023:Zfyve1 UTSW 12 83594522 missense probably benign
R4026:Zfyve1 UTSW 12 83594522 missense probably benign
R4209:Zfyve1 UTSW 12 83575135 missense probably damaging 1.00
R4211:Zfyve1 UTSW 12 83575135 missense probably damaging 1.00
R4780:Zfyve1 UTSW 12 83558647 missense probably damaging 1.00
R4907:Zfyve1 UTSW 12 83574872 missense probably damaging 0.96
R4908:Zfyve1 UTSW 12 83551571 missense probably damaging 1.00
R4998:Zfyve1 UTSW 12 83548065 missense possibly damaging 0.69
R5076:Zfyve1 UTSW 12 83555647 missense probably damaging 1.00
R5303:Zfyve1 UTSW 12 83575056 missense probably damaging 1.00
R5628:Zfyve1 UTSW 12 83574889 missense probably benign 0.00
R6007:Zfyve1 UTSW 12 83558704 missense probably damaging 1.00
R6355:Zfyve1 UTSW 12 83594641 missense probably benign 0.01
R6641:Zfyve1 UTSW 12 83594496 missense probably benign
R6735:Zfyve1 UTSW 12 83594844 missense possibly damaging 0.90
R7222:Zfyve1 UTSW 12 83555005 missense probably benign
R7278:Zfyve1 UTSW 12 83551540 missense probably damaging 1.00
R7464:Zfyve1 UTSW 12 83551487 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATGGACTGGGTCATAGGCTG -3'
(R):5'- TTTTCCTGGGAAGCAGTCATATTTC -3'

Sequencing Primer
(F):5'- GTCATAGGCTGCCCACACTC -3'
(R):5'- GCCCAGCAGTCATATTTC -3'
Posted On2017-12-01