Incidental Mutation 'R5716:Pabpn1l'
ID501375
Institutional Source Beutler Lab
Gene Symbol Pabpn1l
Ensembl Gene ENSMUSG00000069867
Gene Namepoly(A)binding protein nuclear 1-like
SynonymsLOC382035, ePABP2
MMRRC Submission 043187-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.137) question?
Stock #R5716 (G1)
Quality Score137
Status Not validated
Chromosome8
Chromosomal Location122619471-122622739 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 122620421 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 215 (V215A)
Ref Sequence ENSEMBL: ENSMUSP00000090747 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015157] [ENSMUST00000093059] [ENSMUST00000127664] [ENSMUST00000127984] [ENSMUST00000212966]
Predicted Effect probably benign
Transcript: ENSMUST00000015157
SMART Domains Protein: ENSMUSP00000015157
Gene: ENSMUSG00000015013

DomainStartEndE-ValueType
Pfam:Sybindin 5 138 3.3e-12 PFAM
Pfam:Sedlin_N 7 137 7.3e-38 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000093059
AA Change: V215A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000090747
Gene: ENSMUSG00000069867
AA Change: V215A

DomainStartEndE-ValueType
RRM 144 216 2.44e-18 SMART
low complexity region 252 266 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127984
SMART Domains Protein: ENSMUSP00000118997
Gene: ENSMUSG00000006362

DomainStartEndE-ValueType
low complexity region 47 62 N/A INTRINSIC
TAFH 148 238 5.46e-52 SMART
low complexity region 309 318 N/A INTRINSIC
Pfam:NHR2 356 422 2.3e-38 PFAM
PDB:2KYG|C 456 485 2e-10 PDB
Pfam:zf-MYND 533 569 6.9e-10 PFAM
low complexity region 590 613 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183603
Predicted Effect probably damaging
Transcript: ENSMUST00000212966
AA Change: V230A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik T C 11: 58,421,768 V24A possibly damaging Het
Abca14 G A 7: 120,246,994 probably null Het
Acad12 A G 5: 121,609,983 V124A probably benign Het
Alg1 A T 16: 5,239,956 D238V probably damaging Het
Bcar3 A G 3: 122,512,915 E179G probably damaging Het
Brf2 A G 8: 27,126,046 S104P probably benign Het
Coq8a A T 1: 180,179,260 Y21N possibly damaging Het
Cramp1l A G 17: 24,974,735 F924L probably damaging Het
Dpyd G T 3: 118,899,179 C324F probably damaging Het
Eif4b T C 15: 102,082,059 Y33H probably benign Het
Fry C T 5: 150,370,221 Q460* probably null Het
Fryl T C 5: 73,100,465 I665V probably benign Het
Gm9573 A C 17: 35,620,783 probably benign Het
Gpank1 A G 17: 35,123,253 K90E probably damaging Het
Hexdc A G 11: 121,221,562 I482V probably benign Het
Hmcn2 G A 2: 31,336,567 E185K probably damaging Het
Hmcn2 A G 2: 31,458,738 E4922G possibly damaging Het
Ino80d A T 1: 63,058,697 D679E probably benign Het
Kalrn A T 16: 33,987,176 C2608S probably benign Het
Kars T A 8: 112,003,442 probably null Het
Lcn2 A G 2: 32,385,813 V211A possibly damaging Het
Lsmem1 A T 12: 40,180,693 V70E possibly damaging Het
Med12l T C 3: 59,301,377 probably null Het
Megf11 T C 9: 64,506,110 F60L possibly damaging Het
Neb T A 2: 52,210,584 H4438L probably benign Het
Nuf2 C A 1: 169,522,389 V107F probably benign Het
Olfr127 A T 17: 37,903,828 Y94F probably benign Het
Olfr1501 C T 19: 13,838,639 C178Y probably damaging Het
Olfr767 T A 10: 129,079,555 N136I probably benign Het
Pnn A G 12: 59,071,872 I414V probably benign Het
Rab11fip3 A G 17: 26,036,664 Y539H probably damaging Het
Rassf4 A G 6: 116,661,867 V13A probably benign Het
Sephs1 T C 2: 4,884,578 F56L probably benign Het
Sh3rf3 C T 10: 59,131,283 P816S probably benign Het
Skint10 A G 4: 112,711,647 L291P probably damaging Het
Thsd7a T A 6: 12,343,148 I1157L probably benign Het
Tmem184c T C 8: 77,606,407 H85R possibly damaging Het
Tmem94 T C 11: 115,792,428 V679A probably benign Het
Tpcn2 A C 7: 145,257,813 F566V possibly damaging Het
Uqcrc1 A G 9: 108,947,405 N298D probably benign Het
Other mutations in Pabpn1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02563:Pabpn1l APN 8 122620383 missense probably damaging 0.96
R0928:Pabpn1l UTSW 8 122622619 missense probably benign 0.03
R0940:Pabpn1l UTSW 8 122622444 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TCAGGCTCCAAGAATCTTGC -3'
(R):5'- AGGAAGATGCTGGCTATTACC -3'

Sequencing Primer
(F):5'- CAAGAATCTTGCTGCTCAGATC -3'
(R):5'- GGATGTCCTGTGATCACA -3'
Posted On2017-12-01