Incidental Mutation 'R5719:Herc3'
ID501385
Institutional Source Beutler Lab
Gene Symbol Herc3
Ensembl Gene ENSMUSG00000029804
Gene Namehect domain and RLD 3
Synonyms5730409F18Rik
MMRRC Submission 043339-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5719 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location58831465-58920398 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 58894543 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 70 (V70E)
Ref Sequence ENSEMBL: ENSMUSP00000145319 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031823] [ENSMUST00000041401] [ENSMUST00000204629]
Predicted Effect probably benign
Transcript: ENSMUST00000031823
AA Change: V859E

PolyPhen 2 Score 0.364 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000031823
Gene: ENSMUSG00000029804
AA Change: V859E

DomainStartEndE-ValueType
Pfam:RCC1_2 36 65 3.3e-11 PFAM
Pfam:RCC1 52 99 3.6e-15 PFAM
Pfam:RCC1_2 86 115 1.1e-10 PFAM
Pfam:RCC1 102 152 1.4e-16 PFAM
Pfam:RCC1_2 139 168 2.1e-9 PFAM
Pfam:RCC1 155 205 2.6e-16 PFAM
Pfam:RCC1_2 193 221 1.5e-9 PFAM
Pfam:RCC1 208 257 4.7e-17 PFAM
Pfam:RCC1_2 244 273 8e-9 PFAM
Pfam:RCC1 260 309 2.6e-16 PFAM
Pfam:RCC1_2 296 326 2.3e-7 PFAM
Pfam:RCC1 313 377 3.8e-9 PFAM
HECTc 721 913 2.08e-12 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000041401
AA Change: V859E

PolyPhen 2 Score 0.470 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000040025
Gene: ENSMUSG00000029804
AA Change: V859E

DomainStartEndE-ValueType
Pfam:RCC1_2 36 65 1.7e-11 PFAM
Pfam:RCC1 52 99 1.6e-15 PFAM
Pfam:RCC1_2 86 115 1.1e-10 PFAM
Pfam:RCC1 102 152 7.3e-16 PFAM
Pfam:RCC1_2 139 168 1.3e-9 PFAM
Pfam:RCC1 155 205 1.4e-16 PFAM
Pfam:RCC1_2 193 221 5e-10 PFAM
Pfam:RCC1 208 257 1.4e-16 PFAM
Pfam:RCC1_2 244 273 6.1e-8 PFAM
Pfam:RCC1 260 309 1.7e-14 PFAM
Pfam:RCC1_2 296 326 1.1e-7 PFAM
Pfam:RCC1 313 377 6.6e-11 PFAM
HECTc 721 1050 5.79e-157 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000204629
AA Change: V70E

PolyPhen 2 Score 0.666 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000145319
Gene: ENSMUSG00000029804
AA Change: V70E

DomainStartEndE-ValueType
Pfam:HECT 1 97 1.9e-16 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 98% (79/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member the HERC ubiquitin ligase family. The encoded protein is located in the cytosol and binds ubiquitin via a HECT domain. Mutations in this gene have been associated with colorectal and gastric carcinomas. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal hair follicle bulge morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,273,245 H1137Q probably damaging Het
A130051J06Rik C T 15: 95,790,760 probably benign Het
A630001G21Rik T A 1: 85,723,385 R110W probably benign Het
Abca4 T C 3: 122,135,266 probably null Het
Abcc3 T C 11: 94,351,068 N1379S probably damaging Het
Actrt3 A C 3: 30,598,127 F273V probably benign Het
Adam22 T C 5: 8,367,217 D75G probably benign Het
Armc4 G T 18: 7,211,496 Q793K probably benign Het
Ash1l C A 3: 89,054,498 D2392E possibly damaging Het
Ash1l T C 3: 89,058,626 I2445T probably damaging Het
Cacna2d2 A G 9: 107,524,652 I762V probably benign Het
Ccdc127 T A 13: 74,357,068 probably benign Het
Ccdc91 C G 6: 147,575,503 L230V unknown Het
Cdk13 A G 13: 17,719,655 I1129T probably damaging Het
Cnot1 C T 8: 95,744,296 R1308H possibly damaging Het
Crhr2 T C 6: 55,103,222 H144R probably damaging Het
Dnmt1 T C 9: 20,912,595 N993S possibly damaging Het
Eif4g1 T A 16: 20,689,011 V1182D probably damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fam234a T A 17: 26,214,653 Q399L possibly damaging Het
Fyb A T 15: 6,580,869 K308* probably null Het
Gfral C T 9: 76,197,046 R228Q probably benign Het
Gm10309 A T 17: 86,498,993 probably benign Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm5501 G A 18: 9,917,417 noncoding transcript Het
Gm6309 A T 5: 146,168,182 V307D probably benign Het
Gm9871 T A 6: 101,796,187 noncoding transcript Het
Greb1l G A 18: 10,542,427 E1341K probably damaging Het
Hes7 A G 11: 69,121,589 E41G probably damaging Het
Ifi27l2b T C 12: 103,455,787 D106G unknown Het
Igfbp6 A T 15: 102,148,181 Y184F probably damaging Het
Isyna1 A G 8: 70,594,702 Y25C probably damaging Het
Kcng3 G T 17: 83,631,134 T162K possibly damaging Het
Krt36 T C 11: 100,104,161 D195G possibly damaging Het
Lrwd1 A T 5: 136,132,239 probably null Het
Lsg1 C T 16: 30,561,775 A615T probably benign Het
Myo5a A T 9: 75,151,931 E480D probably damaging Het
Myrf T A 19: 10,216,723 D690V probably damaging Het
N4bp1 T C 8: 86,851,684 I684M probably damaging Het
Nlrc3 C T 16: 3,963,725 A607T probably damaging Het
Nuak1 A T 10: 84,409,720 I87N probably damaging Het
Olfr1131 T C 2: 87,629,131 probably null Het
Olfr490 T G 7: 108,286,392 T245P probably damaging Het
Olfr878 A T 9: 37,919,351 E236D probably damaging Het
Osbpl9 T A 4: 109,062,566 R689* probably null Het
Ppargc1b T A 18: 61,307,568 M744L probably benign Het
Prss40 A T 1: 34,552,517 probably benign Het
Ptprd T A 4: 76,054,602 probably null Het
Rft1 T C 14: 30,663,226 probably benign Het
Rftn2 C T 1: 55,214,286 V53I probably damaging Het
Rnaset2a T C 17: 8,132,047 Y167C probably damaging Het
Schip1 T C 3: 68,408,227 probably benign Het
Scn5a A C 9: 119,530,052 L643R possibly damaging Het
Shroom3 T A 5: 92,943,018 M1128K probably benign Het
Skint8 C A 4: 111,950,193 L359M probably damaging Het
Slc14a2 A G 18: 78,209,042 L18P probably benign Het
Slc22a3 C T 17: 12,423,804 V509M probably damaging Het
Slc7a5 A C 8: 121,883,642 F478V probably benign Het
Smc1b T A 15: 85,096,658 N803I probably benign Het
Snf8 T A 11: 96,041,725 N115K probably damaging Het
Stox2 T A 8: 47,413,137 K57* probably null Het
Tmem248 T A 5: 130,229,588 F41I probably damaging Het
Tmprss7 T C 16: 45,686,430 S90G probably damaging Het
Top3b T C 16: 16,885,836 V285A probably damaging Het
Tsen15 T C 1: 152,371,783 T153A probably damaging Het
Usp34 T G 11: 23,354,846 S360A probably benign Het
Wdr24 T C 17: 25,828,340 probably null Het
Zbtb2 G A 10: 4,369,456 T190I probably benign Het
Zranb3 T C 1: 127,963,876 S788G probably benign Het
Other mutations in Herc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Herc3 APN 6 58874263 missense probably damaging 1.00
IGL00423:Herc3 APN 6 58868715 missense probably damaging 0.99
IGL00468:Herc3 APN 6 58918766 missense probably benign 0.04
IGL01153:Herc3 APN 6 58860336 missense probably benign 0.21
IGL01468:Herc3 APN 6 58854895 missense probably benign 0.00
IGL01696:Herc3 APN 6 58860386 missense possibly damaging 0.58
IGL01975:Herc3 APN 6 58916576 missense possibly damaging 0.91
IGL02797:Herc3 APN 6 58868694 missense probably benign
IGL02953:Herc3 APN 6 58857733 nonsense probably null
aegean UTSW 6 58855760 nonsense probably null
PIT4519001:Herc3 UTSW 6 58876811 missense probably damaging 1.00
R0019:Herc3 UTSW 6 58885065 splice site probably benign
R0019:Herc3 UTSW 6 58885065 splice site probably benign
R0025:Herc3 UTSW 6 58874308 missense probably damaging 1.00
R0025:Herc3 UTSW 6 58874308 missense probably damaging 1.00
R0268:Herc3 UTSW 6 58868628 splice site probably benign
R0334:Herc3 UTSW 6 58918817 missense probably damaging 1.00
R0344:Herc3 UTSW 6 58868628 splice site probably benign
R0853:Herc3 UTSW 6 58876564 missense probably damaging 1.00
R0927:Herc3 UTSW 6 58868763 missense possibly damaging 0.48
R1333:Herc3 UTSW 6 58887493 missense probably damaging 1.00
R1432:Herc3 UTSW 6 58916842 missense possibly damaging 0.49
R1450:Herc3 UTSW 6 58876515 nonsense probably null
R1594:Herc3 UTSW 6 58887584 unclassified probably benign
R1757:Herc3 UTSW 6 58916470 missense probably damaging 1.00
R1765:Herc3 UTSW 6 58888660 missense probably damaging 0.99
R1932:Herc3 UTSW 6 58876793 missense probably damaging 0.99
R1945:Herc3 UTSW 6 58887439 missense probably damaging 0.96
R1988:Herc3 UTSW 6 58884975 critical splice donor site probably null
R2172:Herc3 UTSW 6 58887437 missense probably damaging 1.00
R3080:Herc3 UTSW 6 58856646 unclassified probably null
R3545:Herc3 UTSW 6 58856685 missense probably damaging 1.00
R3767:Herc3 UTSW 6 58862988 missense probably benign
R3767:Herc3 UTSW 6 58876602 missense probably benign 0.00
R3805:Herc3 UTSW 6 58916850 missense probably damaging 1.00
R3806:Herc3 UTSW 6 58916850 missense probably damaging 1.00
R4049:Herc3 UTSW 6 58876837 missense probably damaging 0.99
R4250:Herc3 UTSW 6 58916516 missense probably damaging 1.00
R4469:Herc3 UTSW 6 58876809 nonsense probably null
R4534:Herc3 UTSW 6 58860347 missense probably benign
R4573:Herc3 UTSW 6 58894113 missense possibly damaging 0.89
R4887:Herc3 UTSW 6 58887499 missense probably damaging 1.00
R5047:Herc3 UTSW 6 58855760 nonsense probably null
R5049:Herc3 UTSW 6 58894539 splice site probably null
R5062:Herc3 UTSW 6 58855760 nonsense probably null
R5063:Herc3 UTSW 6 58855760 nonsense probably null
R5288:Herc3 UTSW 6 58874278 missense probably damaging 0.99
R5297:Herc3 UTSW 6 58856641 missense probably damaging 1.00
R5386:Herc3 UTSW 6 58874278 missense probably damaging 0.99
R5435:Herc3 UTSW 6 58855806 missense probably damaging 1.00
R5576:Herc3 UTSW 6 58888725 missense probably benign 0.08
R5605:Herc3 UTSW 6 58857727 missense probably damaging 1.00
R5743:Herc3 UTSW 6 58918799 missense probably benign 0.12
R5870:Herc3 UTSW 6 58916450 missense probably benign 0.01
R6460:Herc3 UTSW 6 58890123 missense probably damaging 1.00
R6930:Herc3 UTSW 6 58916459 missense probably damaging 0.98
R7034:Herc3 UTSW 6 58876855 missense probably benign 0.00
R7131:Herc3 UTSW 6 58887424 missense probably damaging 1.00
R7187:Herc3 UTSW 6 58856631 missense probably benign 0.42
R7212:Herc3 UTSW 6 58918773 missense probably damaging 1.00
R7335:Herc3 UTSW 6 58876788 missense possibly damaging 0.95
R7349:Herc3 UTSW 6 58858986 missense probably benign
R7568:Herc3 UTSW 6 58843810 missense probably benign 0.01
R7857:Herc3 UTSW 6 58843652 nonsense probably null
R7940:Herc3 UTSW 6 58843652 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGCACTTAGGATAACTGCCAGG -3'
(R):5'- GCCAAAAGGATGCAGACCTG -3'

Sequencing Primer
(F):5'- GGATAACTGCCAGGACATTTGTTC -3'
(R):5'- GCAGACCTGTAGATAAATGAGCTATC -3'
Posted On2017-12-01