Mutagenetix > Incidental Mutation

Incidental Mutation 'R5758:Tubgcp5'

501386

Institutional Source

Beutler Lab

Gene Symbol

Tubgcp5

Ensembl Gene

ENSMUSG00000033790

Gene Name

tubulin, gamma complex associated protein 5

Synonyms

B130010C12Rik, GCP5

MMRRC Submission

043203-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.961) question?

Stock #

R5758 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

55794154-55831677 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 55818895 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Cysteine at position 713 (R713C)

Ref Sequence

ENSEMBL: ENSMUSP00000146111 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032627] [ENSMUST00000205796] [ENSMUST00000206191]

AlphaFold

Q8BKN5

Predicted Effect

probably damaging
Transcript: ENSMUST00000032627
AA Change: R776C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000032627
Gene: ENSMUSG00000033790
AA Change: R776C

Domain	Start	End	E-Value	Type
low complexity region	109	124	N/A	INTRINSIC
Pfam:Spc97_Spc98	273	942	1.2e-126	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205311

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205718

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205779

Predicted Effect

probably damaging
Transcript: ENSMUST00000205796
AA Change: R713C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000206191

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206789

Meta Mutation Damage Score

0.3038

Coding Region Coverage

1x: 99.5%
3x: 98.8%
10x: 97.4%
20x: 95.5%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	A	G	11: 9,314,536	N2973D	probably damaging	Het
Acan	A	T	7: 79,101,214	E1911V	possibly damaging	Het
Adamts20	T	C	15: 94,394,650	N193S	probably benign	Het
AF067063	T	C	13: 119,828,255	D135G	probably damaging	Het
Arhgap28	T	C	17: 67,873,159	D81G	probably benign	Het
Calhm3	A	G	19: 47,151,751	V301A	probably damaging	Het
Celsr1	C	T	15: 85,941,264	G1556D	probably benign	Het
Cfap221	A	G	1: 119,934,558	L598P	probably benign	Het
Col6a6	T	C	9: 105,761,518		probably null	Het
Dmxl2	T	A	9: 54,472,964	I142F	probably benign	Het
Dpy19l4	C	T	4: 11,276,886	V338M	probably damaging	Het
Dpys	A	C	15: 39,826,999	D319E	possibly damaging	Het
Dsc3	A	G	18: 19,989,534	V111A	probably damaging	Het
Galnt5	T	C	2: 57,998,430	V14A	probably benign	Het
Hebp2	C	A	10: 18,544,407	V93L	probably damaging	Het
Igkv8-21	A	T	6: 70,315,025	S78T	possibly damaging	Het
Jak2	T	A	19: 29,309,643	D1036E	probably damaging	Het
Kazn	A	G	4: 142,141,671		probably null	Het
Kif9	T	C	9: 110,489,879	V143A	probably damaging	Het
Lhcgr	T	C	17: 88,742,548	I517V	probably damaging	Het
Llgl1	T	C	11: 60,708,567	F458S	probably damaging	Het
Mrgprb3	C	A	7: 48,643,319	M161I	probably benign	Het
Muc5b	A	T	7: 141,858,983	I1889F	unknown	Het
Mysm1	A	G	4: 94,952,361	V606A	probably damaging	Het
Nipal3	T	C	4: 135,452,563	D348G	probably benign	Het
Olfml2b	G	A	1: 170,669,264		probably null	Het
Olfr467	T	C	7: 107,814,815	V77A	probably damaging	Het
Olfr497	T	A	7: 108,423,162	V197D	probably benign	Het
Orc5	T	C	5: 22,529,258	D176G	possibly damaging	Het
Rapgef6	A	G	11: 54,668,644	N1041S	probably damaging	Het
Ryr3	G	A	2: 112,841,975	R1384C	probably damaging	Het
Sar1a	A	G	10: 61,685,072	Y22C	probably benign	Het
Shcbp1	T	C	8: 4,749,355		probably null	Het
Smim17	C	T	7: 6,424,789	H25Y	possibly damaging	Het
Trim10	C	T	17: 36,877,152	T420I	possibly damaging	Het
Trip13	G	T	13: 73,937,495	S29R	probably benign	Het
Uckl1	C	A	2: 181,569,953	G420C	probably damaging	Het
Vangl1	A	T	3: 102,184,092	V226D	probably damaging	Het
Zdhhc17	A	G	10: 110,944,395	*633Q	probably null	Het
Zfhx4	A	G	3: 5,402,620	K2613E	probably damaging	Het
Zfp236	G	A	18: 82,671,709	T215M	probably damaging	Het
Zfp563	A	G	17: 33,104,920	H163R	probably damaging	Het
Zfp703	C	T	8: 26,979,205	P299L	probably damaging	Het

Other mutations in Tubgcp5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00969:Tubgcp5	APN	7	55806595	missense	possibly damaging	0.91
IGL01291:Tubgcp5	APN	7	55808529	missense	possibly damaging	0.83
IGL01343:Tubgcp5	APN	7	55796031	splice site	probably benign
IGL01597:Tubgcp5	APN	7	55806832	splice site	probably benign
IGL01688:Tubgcp5	APN	7	55815018	missense	possibly damaging	0.92
IGL01843:Tubgcp5	APN	7	55799473	missense	probably benign	0.02
IGL01950:Tubgcp5	APN	7	55806088	missense	possibly damaging	0.93
IGL01957:Tubgcp5	APN	7	55818757	missense	probably damaging	1.00
IGL02902:Tubgcp5	APN	7	55806607	nonsense	probably null
IGL03105:Tubgcp5	APN	7	55825581	missense	probably damaging	1.00
ANU05:Tubgcp5	UTSW	7	55808529	missense	possibly damaging	0.83
R0078:Tubgcp5	UTSW	7	55818895	missense	probably damaging	1.00
R0322:Tubgcp5	UTSW	7	55814978	missense	probably damaging	0.98
R0362:Tubgcp5	UTSW	7	55800684	missense	probably damaging	1.00
R0449:Tubgcp5	UTSW	7	55823567	missense	probably benign
R0488:Tubgcp5	UTSW	7	55829338	missense	probably damaging	0.96
R0853:Tubgcp5	UTSW	7	55814851	splice site	probably benign
R0885:Tubgcp5	UTSW	7	55806055	nonsense	probably null
R1483:Tubgcp5	UTSW	7	55825707	critical splice donor site	probably null
R1746:Tubgcp5	UTSW	7	55808537	missense	probably benign	0.05
R1766:Tubgcp5	UTSW	7	55815020	missense	probably benign	0.15
R2148:Tubgcp5	UTSW	7	55799511	missense	probably damaging	1.00
R2229:Tubgcp5	UTSW	7	55830881	missense	probably damaging	1.00
R3766:Tubgcp5	UTSW	7	55830866	missense	probably damaging	0.98
R4154:Tubgcp5	UTSW	7	55805329	missense	probably benign	0.01
R4838:Tubgcp5	UTSW	7	55794185	unclassified	probably benign
R4948:Tubgcp5	UTSW	7	55806123	missense	probably benign	0.00
R5110:Tubgcp5	UTSW	7	55808637	missense	probably damaging	0.96
R5347:Tubgcp5	UTSW	7	55823685	missense	probably damaging	1.00
R5417:Tubgcp5	UTSW	7	55825661	missense	possibly damaging	0.90
R5574:Tubgcp5	UTSW	7	55805329	missense	probably benign	0.01
R5957:Tubgcp5	UTSW	7	55814962	missense	probably benign	0.03
R6014:Tubgcp5	UTSW	7	55823609	missense	probably benign
R6141:Tubgcp5	UTSW	7	55806778	missense	probably benign	0.30
R6289:Tubgcp5	UTSW	7	55795923	missense	probably benign	0.05
R6511:Tubgcp5	UTSW	7	55817392	nonsense	probably null
R6563:Tubgcp5	UTSW	7	55825661	missense	possibly damaging	0.90
R6574:Tubgcp5	UTSW	7	55823583	missense	probably benign
R6596:Tubgcp5	UTSW	7	55806634	missense	probably benign	0.38
R7016:Tubgcp5	UTSW	7	55794229	missense	possibly damaging	0.76
R7038:Tubgcp5	UTSW	7	55805366	missense	probably damaging	0.99
R7075:Tubgcp5	UTSW	7	55829407	missense	probably benign	0.04
R7083:Tubgcp5	UTSW	7	55800695	nonsense	probably null
R7213:Tubgcp5	UTSW	7	55806112	missense	probably damaging	0.97
R7284:Tubgcp5	UTSW	7	55823567	missense	probably benign
R7600:Tubgcp5	UTSW	7	55808513	missense	probably benign
R7813:Tubgcp5	UTSW	7	55800696	missense	possibly damaging	0.49
R7920:Tubgcp5	UTSW	7	55816562	missense	probably benign	0.00
R7948:Tubgcp5	UTSW	7	55794248	missense	probably benign	0.01
R8438:Tubgcp5	UTSW	7	55804615	missense	possibly damaging	0.67
R8499:Tubgcp5	UTSW	7	55804615	missense	possibly damaging	0.67
R9087:Tubgcp5	UTSW	7	55817358	missense	probably damaging	1.00
R9211:Tubgcp5	UTSW	7	55806583	missense	probably benign	0.05
R9269:Tubgcp5	UTSW	7	55795945	missense	possibly damaging	0.94
R9329:Tubgcp5	UTSW	7	55829433	critical splice donor site	probably null
R9355:Tubgcp5	UTSW	7	55817429	critical splice donor site	probably null
R9498:Tubgcp5	UTSW	7	55813485	missense	possibly damaging	0.46
R9687:Tubgcp5	UTSW	7	55825579	critical splice acceptor site	probably null
Z1088:Tubgcp5	UTSW	7	55815101	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- CTTGCAGGCCATGAGGAATT -3'
(R):5'- CCTTTGTGTTTCGTCTGGAGATA -3'

Sequencing Primer
(F):5'- TTTTTCTTGATGGAAGGTGGAGAC -3'
(R):5'- GCATGCTTTGAACACTAGCG -3'

Posted On

2017-12-01